Mutagenetix > Incidental Mutation

Incidental Mutation 'R2271:Dnah9'

242497

Institutional Source

Beutler Lab

Gene Symbol

Dnah9

Ensembl Gene

ENSMUSG00000056752

Gene Name

dynein, axonemal, heavy chain 9

Synonyms

D11Ertd686e, Dnahc9

MMRRC Submission

040271-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R2271 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65831282-66168551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66112362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 872 (D872G)

Ref Sequence

ENSEMBL: ENSMUSP00000079494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080665]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080665
AA Change: D872G

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: D872G

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	209	787	3.6e-164	PFAM
coiled coil region	788	820	N/A	INTRINSIC
low complexity region	1228	1240	N/A	INTRINSIC
Pfam:DHC_N2	1290	1699	1.4e-134	PFAM
AAA	1863	1999	4.9e-1	SMART
AAA	2141	2341	1.99e0	SMART
AAA	2468	2614	6.75e-1	SMART
Pfam:AAA_8	2786	3053	1.1e-165	PFAM
Pfam:MT	3065	3408	7.2e-208	PFAM
Pfam:AAA_9	3430	3652	3.2e-87	PFAM
Pfam:Dynein_heavy	3786	4482	1e-241	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	A	10: 28,981,579	Q194L	probably damaging	Het
Acsf2	T	A	11: 94,558,873	K574*	probably null	Het
Adam22	T	C	5: 8,121,108	E614G	probably damaging	Het
Ap4e1	T	C	2: 127,047,163		probably null	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Bcan	T	A	3: 87,993,094	S611C	probably damaging	Het
Birc6	T	C	17: 74,602,971	V1453A	probably benign	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Ccdc146	C	A	5: 21,399,721	D40Y	probably benign	Het
Ccdc83	C	T	7: 90,224,077	V357I	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Cdkl3	T	C	11: 52,032,495	V45A	probably benign	Het
Chd7	A	G	4: 8,785,532	D612G	probably damaging	Het
Chst11	T	C	10: 83,191,170	Y144H	probably damaging	Het
Cops6	A	T	5: 138,161,141	N10I	probably benign	Het
Cyfip1	G	T	7: 55,899,957	R624L	probably null	Het
Cyp27a1	A	G	1: 74,736,687	N344D	probably damaging	Het
Des	T	G	1: 75,363,493	M348R	probably damaging	Het
Dis3l	T	A	9: 64,330,883	D109V	probably damaging	Het
Disp3	C	T	4: 148,271,602	R267Q	possibly damaging	Het
Dnah3	T	A	7: 119,975,129	I2136F	probably benign	Het
Dnajb14	G	A	3: 137,885,380	G31S	probably benign	Het
Dopey1	T	G	9: 86,494,418	V235G	probably damaging	Het
Efcab6	T	A	15: 83,946,999	R571S	probably benign	Het
Emsy	T	G	7: 98,626,623	K352N	probably damaging	Het
Erbb4	T	C	1: 68,198,888	N814S	probably damaging	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fgfbp1	T	A	5: 43,979,330	M207L	probably benign	Het
Filip1	T	C	9: 79,819,930	E469G	probably damaging	Het
Garem2	T	G	5: 30,116,974	L777R	probably damaging	Het
Gm8394	A	G	10: 85,313,731		noncoding transcript	Het
Gm884	T	C	11: 103,614,207	T2312A	possibly damaging	Het
Hkdc1	T	C	10: 62,417,898	T35A	probably benign	Het
Hps6	C	T	19: 46,005,682	A686V	possibly damaging	Het
Irs1	T	C	1: 82,288,459	S679G	probably benign	Het
Ism1	T	A	2: 139,757,373	I415N	probably damaging	Het
Kdm1b	TCATTGTCC	TCATTGTCCATTGTCC	13: 47,064,088		probably null	Het
Kpna1	G	A	16: 36,031,221	A392T	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Mocs1	A	T	17: 49,449,109	K198M	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msh5	A	G	17: 35,044,390	I154T	probably benign	Het
Muc6	T	A	7: 141,637,510	T2417S	possibly damaging	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Ndufv1	C	A	19: 4,008,347	R359L	probably benign	Het
Neu3	G	C	7: 99,813,443	R358G	probably benign	Het
Ntrk3	A	C	7: 78,516,723		probably null	Het
Olfr1045	A	G	2: 86,197,817	F312L	probably benign	Het
Olfr351	G	A	2: 36,859,625	S241F	probably damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pik3c2b	T	C	1: 133,103,428	S1491P	probably benign	Het
Plb1	G	T	5: 32,293,242	D376Y	probably damaging	Het
Plch1	T	A	3: 63,744,535	K378N	probably damaging	Het
Plekhm1	C	T	11: 103,387,122	E383K	probably benign	Het
Plxnb1	T	C	9: 109,102,708		probably null	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prpf8	T	A	11: 75,495,363	V946E	probably damaging	Het
Ptprh	C	A	7: 4,603,133		probably benign	Het
Rngtt	T	A	4: 33,500,302	C565*	probably null	Het
Sacs	A	G	14: 61,204,660	H1385R	probably benign	Het
Sec24a	A	G	11: 51,716,450	S656P	possibly damaging	Het
Serpinb13	A	T	1: 106,999,026	I251L	possibly damaging	Het
Shc1	G	A	3: 89,423,542	G91S	probably damaging	Het
Sin3b	T	A	8: 72,733,419	N211K	probably benign	Het
Slc22a2	A	T	17: 12,586,805	M148L	probably benign	Het
Slc3a1	G	A	17: 85,063,792	V591I	probably benign	Het
Slc47a2	A	T	11: 61,328,526		probably null	Het
Spag17	C	T	3: 100,106,797	P2129S	probably damaging	Het
Specc1l	C	T	10: 75,245,604	S278F	probably damaging	Het
Sphkap	T	A	1: 83,257,221	D1628V	probably damaging	Het
Themis3	C	T	17: 66,555,704	V420I	possibly damaging	Het
Ttc39d	A	G	17: 80,217,246	K445E	probably damaging	Het
U2surp	T	C	9: 95,491,420	E232G	possibly damaging	Het
Usp25	T	A	16: 77,076,429	F458L	probably damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Vmn1r10	A	G	6: 57,114,103	T227A	probably damaging	Het
Zcchc12	C	T	X: 36,198,465	T345M	possibly damaging	Het
Zfp444	T	C	7: 6,189,555	C191R	probably damaging	Het
Zfp729b	A	T	13: 67,592,233	C648S	probably damaging	Het
Zfp799	A	G	17: 32,821,803	Y58H	probably damaging	Het
Zfp938	C	T	10: 82,225,547	G413D	probably damaging	Het

Other mutations in Dnah9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:Dnah9	APN	11	65841238	splice site	probably benign
IGL00805:Dnah9	APN	11	65881695	missense	probably benign	0.00
IGL00826:Dnah9	APN	11	65989942	missense	probably damaging	1.00
IGL01108:Dnah9	APN	11	65849980	missense	possibly damaging	0.93
IGL01152:Dnah9	APN	11	66072056	missense	probably damaging	1.00
IGL01353:Dnah9	APN	11	66080571	missense	probably damaging	1.00
IGL01364:Dnah9	APN	11	66155459	missense	probably damaging	1.00
IGL01479:Dnah9	APN	11	65955717	missense	probably benign	0.14
IGL01537:Dnah9	APN	11	65947680	missense	probably benign
IGL01565:Dnah9	APN	11	66033829	missense	possibly damaging	0.95
IGL01597:Dnah9	APN	11	66118830	missense	probably damaging	1.00
IGL01619:Dnah9	APN	11	65831615	nonsense	probably null
IGL01625:Dnah9	APN	11	66044645	missense	probably damaging	1.00
IGL01803:Dnah9	APN	11	66118829	missense	probably damaging	1.00
IGL01819:Dnah9	APN	11	66108126	missense	probably benign	0.33
IGL01896:Dnah9	APN	11	66130666	missense	possibly damaging	0.89
IGL01922:Dnah9	APN	11	66075034	splice site	probably benign
IGL01923:Dnah9	APN	11	66125235	splice site	probably benign
IGL02059:Dnah9	APN	11	66072958	missense	probably damaging	1.00
IGL02068:Dnah9	APN	11	66061045	missense	probably damaging	1.00
IGL02135:Dnah9	APN	11	66117492	missense	possibly damaging	0.63
IGL02146:Dnah9	APN	11	65927700	missense	probably damaging	1.00
IGL02264:Dnah9	APN	11	66080488	splice site	probably benign
IGL02325:Dnah9	APN	11	65834217	missense	probably damaging	1.00
IGL02426:Dnah9	APN	11	66125153	missense	probably benign
IGL02440:Dnah9	APN	11	65955246	missense	probably damaging	1.00
IGL02471:Dnah9	APN	11	65947618	nonsense	probably null
IGL02496:Dnah9	APN	11	66029363	missense	probably damaging	1.00
IGL02672:Dnah9	APN	11	65927601	missense	probably benign	0.02
IGL02718:Dnah9	APN	11	65886640	missense	probably damaging	0.99
IGL02832:Dnah9	APN	11	66040346	missense	probably damaging	1.00
IGL02851:Dnah9	APN	11	66037744	splice site	probably benign
IGL02859:Dnah9	APN	11	65881619	splice site	probably benign
IGL02864:Dnah9	APN	11	66061003	missense	probably damaging	1.00
IGL02954:Dnah9	APN	11	66118967	missense	probably damaging	1.00
IGL02987:Dnah9	APN	11	65855272	missense	probably damaging	0.98
IGL02987:Dnah9	APN	11	65841273	missense	probably benign	0.23
IGL03160:Dnah9	APN	11	66108054	missense	probably damaging	0.98
IGL03171:Dnah9	APN	11	65981241	missense	probably benign	0.13
IGL03180:Dnah9	APN	11	65886639	missense	probably damaging	0.99
IGL03388:Dnah9	APN	11	65947542	missense	probably damaging	1.00
anarchy	UTSW	11	65955248	missense	probably damaging	0.99
sacco	UTSW	11	66168079	missense	possibly damaging	0.82
Tweed	UTSW	11	66072072	missense	probably damaging	0.99
vanzetti	UTSW	11	65855372	nonsense	probably null
IGL02837:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
PIT4280001:Dnah9	UTSW	11	66005013	missense	probably benign	0.44
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0070:Dnah9	UTSW	11	66160040	missense	probably benign	0.10
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0180:Dnah9	UTSW	11	66147290	missense	probably damaging	1.00
R0195:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R0230:Dnah9	UTSW	11	65855315	missense	probably damaging	1.00
R0243:Dnah9	UTSW	11	65911852	missense	possibly damaging	0.91
R0279:Dnah9	UTSW	11	65911789	critical splice donor site	probably null
R0288:Dnah9	UTSW	11	66025134	critical splice donor site	probably null
R0309:Dnah9	UTSW	11	66026972	splice site	probably benign
R0356:Dnah9	UTSW	11	66130562	critical splice donor site	probably null
R0403:Dnah9	UTSW	11	66084789	missense	possibly damaging	0.90
R0413:Dnah9	UTSW	11	66108135	missense	probably damaging	1.00
R0448:Dnah9	UTSW	11	65918713	splice site	probably benign
R0496:Dnah9	UTSW	11	66075135	missense	probably null	1.00
R0557:Dnah9	UTSW	11	66084666	missense	probably damaging	1.00
R0584:Dnah9	UTSW	11	65990489	missense	probably damaging	1.00
R0598:Dnah9	UTSW	11	66118877	missense	probably benign	0.02
R0599:Dnah9	UTSW	11	65965689	missense	probably damaging	1.00
R0606:Dnah9	UTSW	11	65841333	missense	probably damaging	1.00
R0666:Dnah9	UTSW	11	66085458	missense	probably benign	0.01
R0715:Dnah9	UTSW	11	66081248	splice site	probably benign
R0726:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R0737:Dnah9	UTSW	11	66107898	missense	probably damaging	1.00
R0763:Dnah9	UTSW	11	66155530	missense	probably benign	0.30
R0792:Dnah9	UTSW	11	65896001	missense	possibly damaging	0.84
R0829:Dnah9	UTSW	11	66005176	missense	probably benign	0.00
R0973:Dnah9	UTSW	11	66005837	splice site	probably null
R0974:Dnah9	UTSW	11	66005837	splice site	probably null
R1055:Dnah9	UTSW	11	66160011	missense	probably damaging	1.00
R1081:Dnah9	UTSW	11	66084877	missense	probably damaging	0.99
R1184:Dnah9	UTSW	11	66084612	critical splice donor site	probably null
R1225:Dnah9	UTSW	11	65871060	missense	possibly damaging	0.94
R1304:Dnah9	UTSW	11	65927588	missense	probably damaging	0.98
R1417:Dnah9	UTSW	11	65955747	missense	probably damaging	0.96
R1439:Dnah9	UTSW	11	65874132	missense	probably benign	0.22
R1447:Dnah9	UTSW	11	66108482	missense	possibly damaging	0.65
R1450:Dnah9	UTSW	11	65927786	missense	probably damaging	1.00
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1486:Dnah9	UTSW	11	65834272	missense	probably damaging	1.00
R1519:Dnah9	UTSW	11	65881761	missense	probably damaging	0.96
R1570:Dnah9	UTSW	11	66112330	missense	probably benign
R1617:Dnah9	UTSW	11	65895921	missense	probably damaging	1.00
R1623:Dnah9	UTSW	11	66037637	missense	probably damaging	1.00
R1626:Dnah9	UTSW	11	66085267	missense	probably benign	0.05
R1671:Dnah9	UTSW	11	65927963	missense	probably damaging	0.99
R1694:Dnah9	UTSW	11	65954824	nonsense	probably null
R1701:Dnah9	UTSW	11	65911924	missense	probably damaging	1.00
R1702:Dnah9	UTSW	11	66085195	missense	possibly damaging	0.72
R1708:Dnah9	UTSW	11	65915154	missense	probably benign	0.11
R1718:Dnah9	UTSW	11	66168079	missense	possibly damaging	0.82
R1729:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1760:Dnah9	UTSW	11	65981222	missense	probably benign	0.31
R1784:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1793:Dnah9	UTSW	11	66119594	critical splice donor site	probably null
R1801:Dnah9	UTSW	11	65955297	missense	probably damaging	0.99
R1827:Dnah9	UTSW	11	65850061	missense	probably damaging	0.97
R1836:Dnah9	UTSW	11	66118841	missense	probably benign	0.10
R1840:Dnah9	UTSW	11	65834198	nonsense	probably null
R1847:Dnah9	UTSW	11	65834386	missense	probably damaging	1.00
R1872:Dnah9	UTSW	11	66037490	missense	probably benign	0.16
R1929:Dnah9	UTSW	11	65976398	missense	probably benign	0.05
R1969:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R1971:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R2027:Dnah9	UTSW	11	65955338	missense	probably benign	0.11
R2049:Dnah9	UTSW	11	66044683	missense	probably damaging	1.00
R2064:Dnah9	UTSW	11	66145435	missense	probably benign	0.31
R2104:Dnah9	UTSW	11	66061124	missense	probably damaging	1.00
R2109:Dnah9	UTSW	11	66037585	missense	probably damaging	1.00
R2160:Dnah9	UTSW	11	66117483	missense	probably damaging	1.00
R2172:Dnah9	UTSW	11	66072779	missense	probably damaging	1.00
R2198:Dnah9	UTSW	11	65859499	missense	possibly damaging	0.50
R2272:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2396:Dnah9	UTSW	11	66085158	missense	probably benign	0.01
R2398:Dnah9	UTSW	11	65915203	missense	probably damaging	1.00
R2418:Dnah9	UTSW	11	66095415	nonsense	probably null
R2419:Dnah9	UTSW	11	66095415	nonsense	probably null
R2510:Dnah9	UTSW	11	66005169	missense	probably damaging	1.00
R2680:Dnah9	UTSW	11	66033925	missense	probably benign	0.00
R2875:Dnah9	UTSW	11	66168461	missense	possibly damaging	0.89
R2979:Dnah9	UTSW	11	66117588	missense	possibly damaging	0.89
R3236:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3237:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3433:Dnah9	UTSW	11	66075112	missense	possibly damaging	0.85
R3737:Dnah9	UTSW	11	66156908	nonsense	probably null
R3820:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3821:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3822:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3861:Dnah9	UTSW	11	66052994	splice site	probably benign
R3918:Dnah9	UTSW	11	65870974	missense	possibly damaging	0.54
R4011:Dnah9	UTSW	11	65834464	missense	probably damaging	0.98
R4044:Dnah9	UTSW	11	66133635	missense	probably benign	0.03
R4072:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4076:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4097:Dnah9	UTSW	11	65990459	missense	probably damaging	1.00
R4409:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4410:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4417:Dnah9	UTSW	11	65981214	missense	possibly damaging	0.75
R4420:Dnah9	UTSW	11	66118749	missense	probably benign	0.00
R4434:Dnah9	UTSW	11	66108075	missense	possibly damaging	0.67
R4451:Dnah9	UTSW	11	65881641	missense	probably benign	0.07
R4452:Dnah9	UTSW	11	66027082	missense	probably damaging	0.96
R4454:Dnah9	UTSW	11	66147389	missense	probably damaging	0.96
R4551:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4552:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4590:Dnah9	UTSW	11	66040392	missense	probably damaging	1.00
R4595:Dnah9	UTSW	11	66168152	missense	probably benign
R4655:Dnah9	UTSW	11	65955732	missense	probably benign	0.00
R4667:Dnah9	UTSW	11	66155531	missense	probably benign
R4718:Dnah9	UTSW	11	66085473	missense	probably benign
R4720:Dnah9	UTSW	11	66076358	missense	probably damaging	1.00
R4734:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4749:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4765:Dnah9	UTSW	11	65927726	missense	probably damaging	1.00
R4905:Dnah9	UTSW	11	65874124	nonsense	probably null
R4963:Dnah9	UTSW	11	66084611	splice site	probably null
R5074:Dnah9	UTSW	11	65850040	missense	probably damaging	1.00
R5230:Dnah9	UTSW	11	66084666	missense	probably damaging	0.99
R5262:Dnah9	UTSW	11	66112333	missense	probably benign	0.34
R5364:Dnah9	UTSW	11	65881696	missense	possibly damaging	0.93
R5370:Dnah9	UTSW	11	66029354	missense	probably damaging	1.00
R5386:Dnah9	UTSW	11	66029356	missense	probably damaging	1.00
R5389:Dnah9	UTSW	11	66095314	nonsense	probably null
R5541:Dnah9	UTSW	11	66145336	missense	probably damaging	1.00
R5560:Dnah9	UTSW	11	65881740	missense	probably benign	0.00
R5576:Dnah9	UTSW	11	65834096	splice site	probably null
R5648:Dnah9	UTSW	11	65927755	missense	probably benign	0.00
R5653:Dnah9	UTSW	11	65849980	missense	probably damaging	0.99
R5713:Dnah9	UTSW	11	66025223	missense	possibly damaging	0.92
R5763:Dnah9	UTSW	11	65955239	missense	probably damaging	1.00
R5825:Dnah9	UTSW	11	66126601	missense	probably benign	0.01
R5831:Dnah9	UTSW	11	66108121	missense	probably benign	0.00
R5847:Dnah9	UTSW	11	66095240	frame shift	probably null
R5870:Dnah9	UTSW	11	66085210	missense	probably benign	0.01
R5902:Dnah9	UTSW	11	66025187	missense	probably benign	0.08
R5918:Dnah9	UTSW	11	65834199	missense	probably damaging	1.00
R5979:Dnah9	UTSW	11	65834481	missense	probably damaging	1.00
R6065:Dnah9	UTSW	11	65855338	missense	probably benign	0.05
R6065:Dnah9	UTSW	11	66145397	missense	possibly damaging	0.65
R6086:Dnah9	UTSW	11	65989915	missense	probably damaging	0.99
R6086:Dnah9	UTSW	11	66085174	missense	probably benign
R6102:Dnah9	UTSW	11	65990516	missense	probably damaging	0.97
R6120:Dnah9	UTSW	11	66147399	missense	probably benign
R6154:Dnah9	UTSW	11	65855338	missense	probably benign	0.00
R6262:Dnah9	UTSW	11	65881805	splice site	probably null
R6265:Dnah9	UTSW	11	66168094	missense	probably benign	0.04
R6290:Dnah9	UTSW	11	65841375	missense	probably damaging	1.00
R6345:Dnah9	UTSW	11	66037693	missense	probably damaging	0.97
R6357:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
R6534:Dnah9	UTSW	11	65955248	missense	probably damaging	0.99
R6574:Dnah9	UTSW	11	66168281	missense	probably benign	0.37
R6582:Dnah9	UTSW	11	66061097	missense	probably damaging	1.00
R6700:Dnah9	UTSW	11	65955366	missense	probably damaging	1.00
R6800:Dnah9	UTSW	11	66072739	critical splice donor site	probably null
R6812:Dnah9	UTSW	11	65981329	missense	probably damaging	0.99
R6931:Dnah9	UTSW	11	66117626	missense	possibly damaging	0.63
R6944:Dnah9	UTSW	11	66085149	missense	possibly damaging	0.91
R6958:Dnah9	UTSW	11	66076341	missense	probably damaging	1.00
R6977:Dnah9	UTSW	11	66107909	missense	probably benign	0.37
R7021:Dnah9	UTSW	11	65981231	missense	probably benign
R7161:Dnah9	UTSW	11	65855372	nonsense	probably null
R7175:Dnah9	UTSW	11	66133637	missense	probably benign	0.03
R7199:Dnah9	UTSW	11	66118944	missense	probably benign	0.04
R7231:Dnah9	UTSW	11	65965647	missense	probably damaging	1.00
R7284:Dnah9	UTSW	11	65990476	missense	probably damaging	0.99
R7314:Dnah9	UTSW	11	65989851	missense	probably benign	0.00
R7350:Dnah9	UTSW	11	66080578	missense	probably damaging	1.00
R7420:Dnah9	UTSW	11	66117407	critical splice donor site	probably null
R7427:Dnah9	UTSW	11	65955219	missense	probably benign
R7477:Dnah9	UTSW	11	65992731	missense	probably damaging	0.98
R7515:Dnah9	UTSW	11	65841414	missense	probably benign	0.01
R7521:Dnah9	UTSW	11	65989837	missense	probably damaging	0.98
R7573:Dnah9	UTSW	11	66125215	missense	probably benign	0.43
R7659:Dnah9	UTSW	11	65989780	missense	probably damaging	0.99
R7707:Dnah9	UTSW	11	66118958	missense	probably damaging	1.00
R7749:Dnah9	UTSW	11	65911830	missense	probably damaging	1.00
R7792:Dnah9	UTSW	11	65850013	missense	probably damaging	1.00
R7808:Dnah9	UTSW	11	66005805	nonsense	probably null
R7814:Dnah9	UTSW	11	66005660	missense	probably damaging	1.00
R7818:Dnah9	UTSW	11	66025211	missense	possibly damaging	0.64
R7890:Dnah9	UTSW	11	66072072	missense	probably damaging	0.99
R7976:Dnah9	UTSW	11	65841401	missense	possibly damaging	0.91
R8121:Dnah9	UTSW	11	66017375	missense	probably benign	0.02
R8232:Dnah9	UTSW	11	65855323	missense	possibly damaging	0.91
R8311:Dnah9	UTSW	11	65989818	missense	probably benign	0.00
R8326:Dnah9	UTSW	11	66117626	missense	probably benign	0.01
R8338:Dnah9	UTSW	11	65841241	critical splice donor site	probably null
R8356:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8456:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8468:Dnah9	UTSW	11	65831730	missense	probably benign	0.00
R8721:Dnah9	UTSW	11	66095298	missense	probably damaging	1.00
R8747:Dnah9	UTSW	11	65927990	missense	possibly damaging	0.69
R8798:Dnah9	UTSW	11	65905231	missense	probably damaging	0.99
R8806:Dnah9	UTSW	11	65859483	missense	probably damaging	1.00
R8826:Dnah9	UTSW	11	65849916	missense	probably benign	0.13
R8837:Dnah9	UTSW	11	65855234	missense	possibly damaging	0.72
R8886:Dnah9	UTSW	11	66053014	missense	probably damaging	1.00
R8887:Dnah9	UTSW	11	65855384	missense	probably benign	0.01
R8921:Dnah9	UTSW	11	65911921	missense	probably benign
R8933:Dnah9	UTSW	11	65855252	missense	possibly damaging	0.88
R8949:Dnah9	UTSW	11	66168400	missense	possibly damaging	0.91
R8967:Dnah9	UTSW	11	66125112	critical splice donor site	probably null
R8979:Dnah9	UTSW	11	66005152	missense	probably benign
R8991:Dnah9	UTSW	11	65886680	missense	probably damaging	0.96
R9016:Dnah9	UTSW	11	66108030	missense	probably damaging	0.99
R9025:Dnah9	UTSW	11	66005825	missense	probably damaging	1.00
R9043:Dnah9	UTSW	11	65954854	missense
R9047:Dnah9	UTSW	11	66072099	missense	possibly damaging	0.89
R9076:Dnah9	UTSW	11	66117638	missense	probably benign	0.21
R9113:Dnah9	UTSW	11	65989887	missense	probably damaging	1.00
R9152:Dnah9	UTSW	11	66130631	missense	probably damaging	1.00
R9187:Dnah9	UTSW	11	66005146	missense	probably benign
R9198:Dnah9	UTSW	11	65955744	missense	probably benign	0.02
R9203:Dnah9	UTSW	11	65855287	missense	possibly damaging	0.58
R9234:Dnah9	UTSW	11	66033925	missense	possibly damaging	0.68
R9245:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R9265:Dnah9	UTSW	11	65841255	missense	probably benign	0.01
R9307:Dnah9	UTSW	11	66085474	missense	probably benign	0.14
R9336:Dnah9	UTSW	11	65870949	missense	probably damaging	1.00
R9386:Dnah9	UTSW	11	65947542	missense	probably damaging	1.00
R9498:Dnah9	UTSW	11	65848373	missense	probably damaging	0.99
R9508:Dnah9	UTSW	11	65834263	missense	probably damaging	1.00
R9524:Dnah9	UTSW	11	66085483	missense	possibly damaging	0.92
R9577:Dnah9	UTSW	11	65976521	missense	probably benign	0.00
R9583:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R9587:Dnah9	UTSW	11	66108391	missense	probably null	0.92
R9612:Dnah9	UTSW	11	65927649	missense	probably benign	0.00
R9748:Dnah9	UTSW	11	66085464	missense	possibly damaging	0.51
R9749:Dnah9	UTSW	11	66095376	missense	probably damaging	1.00
R9759:Dnah9	UTSW	11	66075118	missense	probably null	0.93
R9784:Dnah9	UTSW	11	66085134	missense	probably damaging	0.99
V3553:Dnah9	UTSW	11	65970076	missense	probably damaging	1.00
X0027:Dnah9	UTSW	11	66085479	missense	probably benign	0.07
X0028:Dnah9	UTSW	11	65990452	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65895972	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65927853	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65970084	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66037474	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66072835	missense	probably damaging	1.00
Z1177:Dnah9	UTSW	11	66126650	missense	probably damaging	1.00
Z1186:Dnah9	UTSW	11	66085174	missense	probably benign
Z1186:Dnah9	UTSW	11	66147381	missense	probably benign
Z1187:Dnah9	UTSW	11	66085174	missense	probably benign
Z1187:Dnah9	UTSW	11	66147381	missense	probably benign
Z1188:Dnah9	UTSW	11	66085174	missense	probably benign
Z1188:Dnah9	UTSW	11	66147381	missense	probably benign
Z1189:Dnah9	UTSW	11	66085174	missense	probably benign
Z1189:Dnah9	UTSW	11	66147381	missense	probably benign
Z1190:Dnah9	UTSW	11	66085174	missense	probably benign
Z1190:Dnah9	UTSW	11	66147381	missense	probably benign
Z1191:Dnah9	UTSW	11	66085174	missense	probably benign
Z1191:Dnah9	UTSW	11	66147381	missense	probably benign
Z1192:Dnah9	UTSW	11	66085174	missense	probably benign
Z1192:Dnah9	UTSW	11	66147381	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATACCCAGCACTTTGGCCAC -3'
(R):5'- TGATCTTGTCCATCAATGTAGATCCC -3'

Sequencing Primer
(F):5'- TACTCTAATACAGCACGGATTGTTGC -3'
(R):5'- GTAGATCCCTCTTTGACAGAACAG -3'

Posted On

2014-10-16