Incidental Mutation 'R0172:Cep350'
ID24250
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 038444-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0172 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155953447 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 237 (N237S)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104231
Predicted Effect probably benign
Transcript: ENSMUST00000124495
AA Change: N177S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000138762
AA Change: N237S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: N237S

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
R8100:Cep350 UTSW 1 155953402 missense probably damaging 0.97
R8192:Cep350 UTSW 1 155940783 missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155862079 missense probably benign 0.01
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCAACCTTTGTATGCTGGAGCAGG -3'
(R):5'- TGTATTCACGAGGAGAAGCCCGAG -3'

Sequencing Primer
(F):5'- CTGGATGGTCAATATGACCTAGAGTC -3'
(R):5'- TCGGGAAGACCGGAATATCC -3'
Posted On2013-04-16