Incidental Mutation 'R2271:Mrc2'
ID242503
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 040271-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2271 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105348431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably benign
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,981,579 Q194L probably damaging Het
Acsf2 T A 11: 94,558,873 K574* probably null Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc146 C A 5: 21,399,721 D40Y probably benign Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Chd7 A G 4: 8,785,532 D612G probably damaging Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cops6 A T 5: 138,161,141 N10I probably benign Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27a1 A G 1: 74,736,687 N344D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Disp3 C T 4: 148,271,602 R267Q possibly damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Dnajb14 G A 3: 137,885,380 G31S probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Efcab6 T A 15: 83,946,999 R571S probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Hps6 C T 19: 46,005,682 A686V possibly damaging Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mocs1 A T 17: 49,449,109 K198M probably damaging Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Neu3 G C 7: 99,813,443 R358G probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1045 A G 2: 86,197,817 F312L probably benign Het
Olfr351 G A 2: 36,859,625 S241F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pik3c2b T C 1: 133,103,428 S1491P probably benign Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plekhm1 C T 11: 103,387,122 E383K probably benign Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Ptprh C A 7: 4,603,133 probably benign Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Sacs A G 14: 61,204,660 H1385R probably benign Het
Sec24a A G 11: 51,716,450 S656P possibly damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Sin3b T A 8: 72,733,419 N211K probably benign Het
Slc22a2 A T 17: 12,586,805 M148L probably benign Het
Slc3a1 G A 17: 85,063,792 V591I probably benign Het
Slc47a2 A T 11: 61,328,526 probably null Het
Spag17 C T 3: 100,106,797 P2129S probably damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Sphkap T A 1: 83,257,221 D1628V probably damaging Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
U2surp T C 9: 95,491,420 E232G possibly damaging Het
Usp25 T A 16: 77,076,429 F458L probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r10 A G 6: 57,114,103 T227A probably damaging Het
Zcchc12 C T X: 36,198,465 T345M possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTTGCACTTGAGCTGCCAG -3'
(R):5'- TGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'
Posted On2014-10-16