Incidental Mutation 'R2271:Usp7'
ID242510
Institutional Source Beutler Lab
Gene Symbol Usp7
Ensembl Gene ENSMUSG00000022710
Gene Nameubiquitin specific peptidase 7
Synonyms2210010O09Rik
MMRRC Submission 040271-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2271 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location8689595-8792308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8698469 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 649 (S649G)
Ref Sequence ENSEMBL: ENSMUSP00000124382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160326] [ENSMUST00000160405] [ENSMUST00000161046] [ENSMUST00000172505]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159387
Predicted Effect probably benign
Transcript: ENSMUST00000160326
SMART Domains Protein: ENSMUSP00000124576
Gene: ENSMUSG00000022710

DomainStartEndE-ValueType
PDB:2F1Z|B 43 83 2e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160405
AA Change: S649G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124382
Gene: ENSMUSG00000022710
AA Change: S649G

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
MATH 111 217 4.27e-22 SMART
Pfam:UCH 254 559 5.7e-53 PFAM
Pfam:UCH_1 255 528 3.7e-22 PFAM
Pfam:USP7_ICP0_bdg 661 906 7.1e-79 PFAM
Pfam:USP7_C2 916 1127 4.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161046
AA Change: S609G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124093
Gene: ENSMUSG00000022710
AA Change: S609G

DomainStartEndE-ValueType
MATH 71 177 4.27e-22 SMART
Pfam:UCH 214 519 9.6e-60 PFAM
Pfam:UCH_1 215 488 5.1e-29 PFAM
Pfam:USP7_ICP0_bdg 620 866 5e-83 PFAM
Pfam:USP7_C2 875 1089 2.7e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162929
Predicted Effect probably benign
Transcript: ENSMUST00000172505
SMART Domains Protein: ENSMUSP00000133398
Gene: ENSMUSG00000022710

DomainStartEndE-ValueType
Pfam:UCH_1 5 247 1.7e-18 PFAM
Pfam:UCH 5 278 2.8e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173939
Meta Mutation Damage Score 0.1010 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C19 family, which includes ubiquitinyl hydrolases. This protein deubiquitinates target proteins such as p53 (a tumor suppressor protein) and WASH (essential for endosomal protein recycling), and regulates their activities by counteracting the opposing ubiquitin ligase activity of proteins such as HDM2 and TRIM27, involved in the respective process. Mutations in this gene have been implicated in a neurodevelopmental disorder. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic growth arrest and die between E6.5 and E7.5. Mice homozygous for a conditional allele activated in neural cells exhibit complete neonatal lethality, absent gastric milk, uncoordinated movement and abnormalforebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,981,579 Q194L probably damaging Het
Acsf2 T A 11: 94,558,873 K574* probably null Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc146 C A 5: 21,399,721 D40Y probably benign Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Chd7 A G 4: 8,785,532 D612G probably damaging Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cops6 A T 5: 138,161,141 N10I probably benign Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27a1 A G 1: 74,736,687 N344D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Disp3 C T 4: 148,271,602 R267Q possibly damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Dnajb14 G A 3: 137,885,380 G31S probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Efcab6 T A 15: 83,946,999 R571S probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Hps6 C T 19: 46,005,682 A686V possibly damaging Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mocs1 A T 17: 49,449,109 K198M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Neu3 G C 7: 99,813,443 R358G probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1045 A G 2: 86,197,817 F312L probably benign Het
Olfr351 G A 2: 36,859,625 S241F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pik3c2b T C 1: 133,103,428 S1491P probably benign Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plekhm1 C T 11: 103,387,122 E383K probably benign Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Ptprh C A 7: 4,603,133 probably benign Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Sacs A G 14: 61,204,660 H1385R probably benign Het
Sec24a A G 11: 51,716,450 S656P possibly damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Sin3b T A 8: 72,733,419 N211K probably benign Het
Slc22a2 A T 17: 12,586,805 M148L probably benign Het
Slc3a1 G A 17: 85,063,792 V591I probably benign Het
Slc47a2 A T 11: 61,328,526 probably null Het
Spag17 C T 3: 100,106,797 P2129S probably damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Sphkap T A 1: 83,257,221 D1628V probably damaging Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
U2surp T C 9: 95,491,420 E232G possibly damaging Het
Usp25 T A 16: 77,076,429 F458L probably damaging Het
Vmn1r10 A G 6: 57,114,103 T227A probably damaging Het
Zcchc12 C T X: 36,198,465 T345M possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Usp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Usp7 APN 16 8697975 missense probably damaging 0.96
IGL00496:Usp7 APN 16 8695113 missense probably damaging 0.99
IGL02113:Usp7 APN 16 8716513 critical splice donor site probably null
IGL02873:Usp7 APN 16 8695194 unclassified probably benign
IGL03036:Usp7 APN 16 8738214 missense probably benign 0.00
PIT4402001:Usp7 UTSW 16 8698495 missense probably benign
R0066:Usp7 UTSW 16 8691418 missense probably benign
R0400:Usp7 UTSW 16 8716632 splice site probably benign
R0483:Usp7 UTSW 16 8699262 missense probably damaging 1.00
R0625:Usp7 UTSW 16 8704982 missense probably benign 0.00
R0626:Usp7 UTSW 16 8693914 missense possibly damaging 0.54
R0837:Usp7 UTSW 16 8703502 missense probably damaging 1.00
R0967:Usp7 UTSW 16 8696654 unclassified probably benign
R1929:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2270:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2272:Usp7 UTSW 16 8698469 missense probably benign 0.00
R3949:Usp7 UTSW 16 8716564 missense probably damaging 1.00
R4411:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4413:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4500:Usp7 UTSW 16 8695895 missense possibly damaging 0.89
R4651:Usp7 UTSW 16 8698414 intron probably benign
R4852:Usp7 UTSW 16 8756844 nonsense probably null
R5483:Usp7 UTSW 16 8698540 missense probably benign
R5610:Usp7 UTSW 16 8716510 splice site probably null
R5734:Usp7 UTSW 16 8701981 missense possibly damaging 0.91
R5964:Usp7 UTSW 16 8712102 missense possibly damaging 0.52
R6753:Usp7 UTSW 16 8696911 missense probably benign 0.25
R7171:Usp7 UTSW 16 8716526 missense probably benign 0.01
R7263:Usp7 UTSW 16 8696724 missense possibly damaging 0.89
R7420:Usp7 UTSW 16 8710121 missense probably benign
R7654:Usp7 UTSW 16 8702043 missense probably benign 0.33
R7789:Usp7 UTSW 16 8698811 missense probably benign
R7808:Usp7 UTSW 16 8705163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGATTCTGACTGCTGGGTC -3'
(R):5'- AGACTTGCTGTATGTGCCG -3'

Sequencing Primer
(F):5'- TCAGGAGCTTGGCTGGC -3'
(R):5'- TATGTGCCGGGAAGTGCC -3'
Posted On2014-10-16