Incidental Mutation 'R2271:Kpna1'
ID242513
Institutional Source Beutler Lab
Gene Symbol Kpna1
Ensembl Gene ENSMUSG00000022905
Gene Namekaryopherin (importin) alpha 1
Synonymsm-importin-alpha-S1, Rch2, NPI1, mSRP1
MMRRC Submission 040271-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R2271 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35978750-36037131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36031221 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 392 (A392T)
Ref Sequence ENSEMBL: ENSMUSP00000004054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004054] [ENSMUST00000172534] [ENSMUST00000173696]
Predicted Effect probably damaging
Transcript: ENSMUST00000004054
AA Change: A392T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004054
Gene: ENSMUSG00000022905
AA Change: A392T

DomainStartEndE-ValueType
Pfam:IBB 6 104 1.3e-27 PFAM
ARM 115 156 1.47e-2 SMART
ARM 158 198 2.51e-10 SMART
ARM 200 241 7.16e-6 SMART
ARM 244 283 2.22e1 SMART
ARM 285 325 1.45e-6 SMART
ARM 327 367 1.12e-7 SMART
ARM 369 409 1.76e-5 SMART
ARM 412 452 2.91e-6 SMART
Pfam:Arm_3 466 516 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173641
SMART Domains Protein: ENSMUSP00000133664
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
ARM 16 57 7.16e-6 SMART
ARM 60 99 2.22e1 SMART
ARM 117 157 6.39e-3 SMART
Pfam:Arm_3 171 221 1.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173696
SMART Domains Protein: ENSMUSP00000134534
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 2 105 9.3e-31 PFAM
Blast:ARM 114 149 1e-14 BLAST
Meta Mutation Damage Score 0.2681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. This protein interacts with the recombination activating gene 1 (RAG1) protein and is a putative substrate of the RAG1 ubiquitin ligase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any nervous system or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,981,579 Q194L probably damaging Het
Acsf2 T A 11: 94,558,873 K574* probably null Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc146 C A 5: 21,399,721 D40Y probably benign Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Chd7 A G 4: 8,785,532 D612G probably damaging Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cops6 A T 5: 138,161,141 N10I probably benign Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27a1 A G 1: 74,736,687 N344D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Disp3 C T 4: 148,271,602 R267Q possibly damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Dnajb14 G A 3: 137,885,380 G31S probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Efcab6 T A 15: 83,946,999 R571S probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Hps6 C T 19: 46,005,682 A686V possibly damaging Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mocs1 A T 17: 49,449,109 K198M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Neu3 G C 7: 99,813,443 R358G probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1045 A G 2: 86,197,817 F312L probably benign Het
Olfr351 G A 2: 36,859,625 S241F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pik3c2b T C 1: 133,103,428 S1491P probably benign Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plekhm1 C T 11: 103,387,122 E383K probably benign Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Ptprh C A 7: 4,603,133 probably benign Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Sacs A G 14: 61,204,660 H1385R probably benign Het
Sec24a A G 11: 51,716,450 S656P possibly damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Sin3b T A 8: 72,733,419 N211K probably benign Het
Slc22a2 A T 17: 12,586,805 M148L probably benign Het
Slc3a1 G A 17: 85,063,792 V591I probably benign Het
Slc47a2 A T 11: 61,328,526 probably null Het
Spag17 C T 3: 100,106,797 P2129S probably damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Sphkap T A 1: 83,257,221 D1628V probably damaging Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
U2surp T C 9: 95,491,420 E232G possibly damaging Het
Usp25 T A 16: 77,076,429 F458L probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r10 A G 6: 57,114,103 T227A probably damaging Het
Zcchc12 C T X: 36,198,465 T345M possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Kpna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Kpna1 APN 16 36012889 intron probably benign
IGL01653:Kpna1 APN 16 36020192 missense probably benign
IGL02412:Kpna1 APN 16 36031191 missense probably benign 0.06
IGL03102:Kpna1 APN 16 36012919 missense probably damaging 1.00
IGL03340:Kpna1 APN 16 36000246 missense probably damaging 1.00
R0040:Kpna1 UTSW 16 36023241 missense probably damaging 0.97
R0456:Kpna1 UTSW 16 36002900 missense possibly damaging 0.94
R0457:Kpna1 UTSW 16 36002905 missense probably benign 0.03
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R2225:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2226:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2227:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2251:Kpna1 UTSW 16 36021569 missense possibly damaging 0.93
R2252:Kpna1 UTSW 16 36021569 missense possibly damaging 0.93
R3952:Kpna1 UTSW 16 36002882 missense probably benign 0.13
R4771:Kpna1 UTSW 16 36033403 missense probably damaging 1.00
R4954:Kpna1 UTSW 16 36033326 missense probably damaging 1.00
R5075:Kpna1 UTSW 16 36009352 missense probably damaging 1.00
R5824:Kpna1 UTSW 16 36020205 missense possibly damaging 0.91
R5873:Kpna1 UTSW 16 36014228 intron probably benign
R6221:Kpna1 UTSW 16 36020688 missense probably benign 0.02
R6603:Kpna1 UTSW 16 36029520 critical splice acceptor site probably null
R7168:Kpna1 UTSW 16 36015962 intron probably benign
R7447:Kpna1 UTSW 16 36029639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTGGGTCTATGCATTC -3'
(R):5'- GAAATTCCTTTCTTAGTGGTCAAGG -3'

Sequencing Primer
(F):5'- GTCTACTTAGCAAGTTCCAGGTCAG -3'
(R):5'- CCTTTCTTAGTGGTCAAGGTTTTAG -3'
Posted On2014-10-16