Mutagenetix > Incidental Mutation

Incidental Mutation 'R2272:Brinp3'

242529

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

040272-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R2272 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 146901404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 530 (R530G)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074622
AA Change: R530G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: R530G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166814
AA Change: R530G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: R530G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	A	T	1: 165,510,297	E160V	probably damaging	Het
Ago1	C	A	4: 126,453,650	M435I	probably benign	Het
Apol7b	G	A	15: 77,423,710	A195V	probably damaging	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atg2b	C	T	12: 105,638,008	V1545I	probably benign	Het
Atp4a	C	A	7: 30,715,500	S238*	probably null	Het
Birc6	T	C	17: 74,602,971	V1453A	probably benign	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Cdkl3	T	C	11: 52,032,495	V45A	probably benign	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Cyfip1	G	T	7: 55,899,957	R624L	probably null	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnah10	A	G	5: 124,731,466	N195S	probably benign	Het
Dnah9	T	C	11: 66,112,362	D872G	probably benign	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fmo1	A	T	1: 162,833,855	D286E	probably damaging	Het
Fmo4	A	T	1: 162,799,047	I310N	possibly damaging	Het
Gm13088	G	A	4: 143,654,142	T437I	probably damaging	Het
Hydin	A	T	8: 110,309,132	I152L	probably benign	Het
Itpr1	T	A	6: 108,493,755	C2214S	probably damaging	Het
Kcnq3	T	A	15: 66,028,680	D242V	probably damaging	Het
Klhl1	T	C	14: 96,517,908	D137G	probably benign	Het
Lama5	T	C	2: 180,178,603	D3282G	possibly damaging	Het
Lhx8	A	G	3: 154,316,762	L254S	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Matn4	A	T	2: 164,397,242	C232S	possibly damaging	Het
Mios	C	T	6: 8,226,865	R614C	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Muc6	T	A	7: 141,637,510	T2417S	possibly damaging	Het
Mycbp2	T	C	14: 103,144,338	H3612R	probably null	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
Myo7b	C	T	18: 31,977,043	S1122N	probably benign	Het
Myo9a	T	A	9: 59,815,301	F549I	probably damaging	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Neil1	A	G	9: 57,146,785	S84P	probably damaging	Het
Nfix	A	G	8: 84,727,175	I256T	probably damaging	Het
Nlrp4f	A	T	13: 65,194,408	D474E	probably benign	Het
Olfr203	T	G	16: 59,303,444	M98R	possibly damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pcnx	T	C	12: 81,995,314	V2240A	probably benign	Het
Per3	T	A	4: 151,018,885	Y530F	probably damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prpf8	T	A	11: 75,495,363	V946E	probably damaging	Het
Prrc1	G	T	18: 57,381,646	D312Y	probably damaging	Het
Prss54	C	T	8: 95,571,107	W45*	probably null	Het
Psg29	A	T	7: 17,210,696	N377I	probably benign	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Serpinb9c	C	T	13: 33,154,541	G125E	probably damaging	Het
Skint4	A	G	4: 112,119,868	T152A	probably benign	Het
Slc26a2	A	G	18: 61,198,578	C594R	possibly damaging	Het
Slc47a2	A	T	11: 61,328,526		probably null	Het
Ttc39d	A	G	17: 80,217,246	K445E	probably damaging	Het
Ttn	T	A	2: 76,764,520	E20394V	probably damaging	Het
Ugt2b36	A	G	5: 87,066,255	V510A	possibly damaging	Het
Usf1	T	C	1: 171,418,060	L291P	possibly damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Vmn1r172	A	C	7: 23,660,191	D167A	probably damaging	Het
Wnt10b	T	A	15: 98,774,347	Q163L	probably damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146746496	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGCAACACAGGCTACATGC -3'
(R):5'- AGTCTGGAAAGCTGCTCTCAC -3'

Sequencing Primer
(F):5'- ACAGGCTACATGCTGAGC -3'
(R):5'- TGGAAAGCTGCTCTCACTCACAG -3'

Posted On

2014-10-16