Incidental Mutation 'R2272:Usf1'
ID242533
Institutional Source Beutler Lab
Gene Symbol Usf1
Ensembl Gene ENSMUSG00000026641
Gene Nameupstream transcription factor 1
SynonymsbHLHb11, upstream stimulatory factor
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171411313-171419142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171418060 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 291 (L291P)
Ref Sequence ENSEMBL: ENSMUSP00000128913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001284] [ENSMUST00000159207] [ENSMUST00000160486] [ENSMUST00000161241] [ENSMUST00000167546] [ENSMUST00000171362]
AlphaFold Q61069
Predicted Effect probably benign
Transcript: ENSMUST00000001284
Predicted Effect probably benign
Transcript: ENSMUST00000159207
SMART Domains Protein: ENSMUSP00000124000
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160335
Predicted Effect probably benign
Transcript: ENSMUST00000160486
SMART Domains Protein: ENSMUSP00000125363
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161241
AA Change: L291P

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125729
Gene: ENSMUSG00000026641
AA Change: L291P

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161297
Predicted Effect possibly damaging
Transcript: ENSMUST00000167546
AA Change: L291P

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128913
Gene: ENSMUSG00000026641
AA Change: L291P

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171362
SMART Domains Protein: ENSMUSP00000132771
Gene: ENSMUSG00000103711

DomainStartEndE-ValueType
RHOD 25 133 2.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194029
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This protein encoded by this gene is a member of the basic-Helix-Hoop-Helix-Leucine zipper (bHLH-LZ) family and encodes a protein that can act as a transcription factor. Studies indicate that the basic region interacts with DNA at E-Box motifs, while the helix-loop-helix and leucine zipper domains are involved in dimerization with different partners. This protein is involved in a wide array of biological pathways, including cell cycle regulation, immune response, and responses to ultraviolet radiation. Mice lacking most of the coding exons of this gene often lacked both whiskers and nasal fur, and were prone to epileptic seizures, while mice lacking both this gene and another family member, Usf2, displayed embryonic lethality (PMID:9520440). Mutations in the human ortholog of this gene have been associated with Familial Combined Hyperlipidemia (FCHL) in humans. Pseudogenes of this gene are found on chromosome 11 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mutants exhibit slight behavioral abnormalities. Females exhibit barbering and some have seizures. This knockout mutation (heterozygous or homozygous) acts as an enhancer of a null mutation of Usf2, resulting in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Usf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usf1 APN 1 171417275 missense probably damaging 0.98
IGL01658:Usf1 APN 1 171417299 missense possibly damaging 0.93
IGL01921:Usf1 APN 1 171416856 missense possibly damaging 0.94
IGL02307:Usf1 APN 1 171415746 missense probably damaging 0.99
R0661:Usf1 UTSW 1 171417499 missense probably damaging 0.97
R1075:Usf1 UTSW 1 171418109 missense probably benign 0.22
R1652:Usf1 UTSW 1 171417749 missense probably damaging 1.00
R4697:Usf1 UTSW 1 171416964 missense possibly damaging 0.55
R4999:Usf1 UTSW 1 171415763 missense probably damaging 0.98
R5940:Usf1 UTSW 1 171417779 missense possibly damaging 0.95
R7430:Usf1 UTSW 1 171417727 missense probably benign
R7863:Usf1 UTSW 1 171417817 nonsense probably null
R7866:Usf1 UTSW 1 171417894 missense unknown
R8966:Usf1 UTSW 1 171417533 critical splice donor site probably null
R8972:Usf1 UTSW 1 171417784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTAACTCCAGGATGGC -3'
(R):5'- TTTCACACCACTCACTGCAG -3'

Sequencing Primer
(F):5'- TCCAGGATGGCCCCCTTG -3'
(R):5'- TCACTGCAGACTGCCACG -3'
Posted On2014-10-16