Incidental Mutation 'R2272:Mios'
ID 242552
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Name meiosis regulator for oocyte development
Synonyms
MMRRC Submission 040272-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R2272 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 8209222-8236274 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8226865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 614 (R614C)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
AlphaFold Q8VE19
Predicted Effect possibly damaging
Transcript: ENSMUST00000040017
AA Change: R614C

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: R614C

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161134
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,337,866 (GRCm39) E160V probably damaging Het
Ago1 C A 4: 126,347,443 (GRCm39) M435I probably benign Het
Apol7b G A 15: 77,307,910 (GRCm39) A195V probably damaging Het
Arid3c T A 4: 41,724,744 (GRCm39) I364F probably damaging Het
Atg2b C T 12: 105,604,267 (GRCm39) V1545I probably benign Het
Atp4a C A 7: 30,414,925 (GRCm39) S238* probably null Het
Birc6 T C 17: 74,909,966 (GRCm39) V1453A probably benign Het
Bmal2 T C 6: 146,723,612 (GRCm39) F314S probably damaging Het
Brinp3 A G 1: 146,777,142 (GRCm39) R530G possibly damaging Het
Carnmt1 T C 19: 18,680,734 (GRCm39) L336P probably damaging Het
Cdh22 A T 2: 164,985,767 (GRCm39) probably null Het
Cdk5rap2 A C 4: 70,184,915 (GRCm39) S1178R probably benign Het
Cdkl3 T C 11: 51,923,322 (GRCm39) V45A probably benign Het
Cracr2a T A 6: 127,584,261 (GRCm39) F107I probably damaging Het
Cyfip1 G T 7: 55,549,705 (GRCm39) R624L probably null Het
Ddc T C 11: 11,785,764 (GRCm39) N308D probably damaging Het
Dnah10 A G 5: 124,808,530 (GRCm39) N195S probably benign Het
Dnah9 T C 11: 66,003,188 (GRCm39) D872G probably benign Het
Fmo1 A T 1: 162,661,424 (GRCm39) D286E probably damaging Het
Fmo4 A T 1: 162,626,616 (GRCm39) I310N possibly damaging Het
Garin5b T A 7: 4,761,186 (GRCm39) T509S probably benign Het
Hydin A T 8: 111,035,764 (GRCm39) I152L probably benign Het
Itpr1 T A 6: 108,470,716 (GRCm39) C2214S probably damaging Het
Kcnq3 T A 15: 65,900,529 (GRCm39) D242V probably damaging Het
Klhl1 T C 14: 96,755,344 (GRCm39) D137G probably benign Het
Lama5 T C 2: 179,820,396 (GRCm39) D3282G possibly damaging Het
Lhx8 A G 3: 154,022,399 (GRCm39) L254S probably damaging Het
Lipa T A 19: 34,488,290 (GRCm39) R119* probably null Het
Matn4 A T 2: 164,239,162 (GRCm39) C232S possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Muc6 T A 7: 141,217,423 (GRCm39) T2417S possibly damaging Het
Mycbp2 T C 14: 103,381,774 (GRCm39) H3612R probably null Het
Myo5b G T 18: 74,866,996 (GRCm39) L1382F probably damaging Het
Myo7b C T 18: 32,110,096 (GRCm39) S1122N probably benign Het
Myo9a T A 9: 59,722,584 (GRCm39) F549I probably damaging Het
Ncbp2 T C 16: 31,775,769 (GRCm39) Y138H probably damaging Het
Neil1 A G 9: 57,054,069 (GRCm39) S84P probably damaging Het
Nfix A G 8: 85,453,804 (GRCm39) I256T probably damaging Het
Nlrp4f A T 13: 65,342,222 (GRCm39) D474E probably benign Het
Or5ac21 T G 16: 59,123,807 (GRCm39) M98R possibly damaging Het
Or8b12i T A 9: 20,082,705 (GRCm39) H54L possibly damaging Het
Pcnx1 T C 12: 82,042,088 (GRCm39) V2240A probably benign Het
Per3 T A 4: 151,103,342 (GRCm39) Y530F probably damaging Het
Pes1 C A 11: 3,919,524 (GRCm39) L66I probably damaging Het
Pramel22 G A 4: 143,380,712 (GRCm39) T437I probably damaging Het
Prkdc A G 16: 15,472,681 (GRCm39) probably null Het
Prpf8 T A 11: 75,386,189 (GRCm39) V946E probably damaging Het
Prrc1 G T 18: 57,514,718 (GRCm39) D312Y probably damaging Het
Prss54 C T 8: 96,297,735 (GRCm39) W45* probably null Het
Psg29 A T 7: 16,944,621 (GRCm39) N377I probably benign Het
Rab3gap2 T A 1: 185,015,739 (GRCm39) probably null Het
Serpinb9c C T 13: 33,338,524 (GRCm39) G125E probably damaging Het
Skint4 A G 4: 111,977,065 (GRCm39) T152A probably benign Het
Slc26a2 A G 18: 61,331,650 (GRCm39) C594R possibly damaging Het
Slc47a2 A T 11: 61,219,352 (GRCm39) probably null Het
Ttc39d A G 17: 80,524,675 (GRCm39) K445E probably damaging Het
Ttn T A 2: 76,594,864 (GRCm39) E20394V probably damaging Het
Ugt2b36 A G 5: 87,214,114 (GRCm39) V510A possibly damaging Het
Usf1 T C 1: 171,245,628 (GRCm39) L291P possibly damaging Het
Usp7 T C 16: 8,516,333 (GRCm39) S649G probably benign Het
Vmn1r172 A C 7: 23,359,616 (GRCm39) D167A probably damaging Het
Wnt10b T A 15: 98,672,228 (GRCm39) Q163L probably damaging Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8,234,363 (GRCm39) critical splice donor site probably null
IGL01365:Mios APN 6 8,216,089 (GRCm39) nonsense probably null
IGL01548:Mios APN 6 8,234,252 (GRCm39) missense possibly damaging 0.90
IGL01898:Mios APN 6 8,222,668 (GRCm39) missense probably benign 0.03
IGL02110:Mios APN 6 8,215,565 (GRCm39) missense probably damaging 1.00
IGL02308:Mios APN 6 8,231,269 (GRCm39) missense probably benign 0.06
IGL02375:Mios APN 6 8,222,598 (GRCm39) missense probably benign 0.02
IGL02452:Mios APN 6 8,222,492 (GRCm39) missense probably benign 0.01
IGL02670:Mios APN 6 8,235,378 (GRCm39) splice site probably benign
IGL03083:Mios APN 6 8,215,156 (GRCm39) missense probably damaging 1.00
R0462:Mios UTSW 6 8,215,743 (GRCm39) missense probably benign 0.11
R0591:Mios UTSW 6 8,215,470 (GRCm39) missense possibly damaging 0.52
R1351:Mios UTSW 6 8,228,120 (GRCm39) missense possibly damaging 0.70
R1476:Mios UTSW 6 8,234,237 (GRCm39) missense probably benign 0.01
R1802:Mios UTSW 6 8,216,385 (GRCm39) nonsense probably null
R1959:Mios UTSW 6 8,215,437 (GRCm39) missense probably benign 0.17
R1964:Mios UTSW 6 8,215,798 (GRCm39) missense probably damaging 0.99
R2915:Mios UTSW 6 8,214,935 (GRCm39) missense possibly damaging 0.72
R3852:Mios UTSW 6 8,216,453 (GRCm39) missense probably benign 0.09
R3876:Mios UTSW 6 8,233,189 (GRCm39) missense probably damaging 0.98
R3948:Mios UTSW 6 8,215,496 (GRCm39) missense probably benign
R4698:Mios UTSW 6 8,228,113 (GRCm39) missense possibly damaging 0.60
R4785:Mios UTSW 6 8,222,464 (GRCm39) missense probably benign
R4789:Mios UTSW 6 8,235,429 (GRCm39) missense probably benign 0.06
R4866:Mios UTSW 6 8,214,857 (GRCm39) missense probably damaging 1.00
R4878:Mios UTSW 6 8,215,094 (GRCm39) missense probably benign 0.00
R4991:Mios UTSW 6 8,215,847 (GRCm39) missense probably benign 0.00
R5479:Mios UTSW 6 8,215,314 (GRCm39) missense probably benign 0.00
R5714:Mios UTSW 6 8,215,434 (GRCm39) missense probably damaging 0.99
R6030:Mios UTSW 6 8,215,704 (GRCm39) missense probably benign 0.11
R6030:Mios UTSW 6 8,215,704 (GRCm39) missense probably benign 0.11
R6111:Mios UTSW 6 8,214,836 (GRCm39) missense probably benign 0.01
R6455:Mios UTSW 6 8,231,239 (GRCm39) missense probably benign 0.03
R7381:Mios UTSW 6 8,216,064 (GRCm39) missense probably damaging 0.98
R8350:Mios UTSW 6 8,227,998 (GRCm39) missense probably benign 0.00
R8708:Mios UTSW 6 8,234,255 (GRCm39) missense probably benign 0.17
R8913:Mios UTSW 6 8,215,924 (GRCm39) missense probably benign
R9062:Mios UTSW 6 8,233,221 (GRCm39) missense probably benign 0.00
R9359:Mios UTSW 6 8,214,894 (GRCm39) missense probably benign 0.17
R9521:Mios UTSW 6 8,233,171 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGGTCTGTCTGCATTTGAAGGAC -3'
(R):5'- GCCTGAGTTTAAAACTTGTATCTGC -3'

Sequencing Primer
(F):5'- GACAAAGCTTCACTGTTAAGGAC -3'
(R):5'- GTATCTGCTAAGTTCTTCAAAATGC -3'
Posted On 2014-10-16