Mutagenetix > Incidental Mutation

Incidental Mutation 'R2272:Atp4a'

242563

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

040272-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R2272 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 30715500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 238 (S238*)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000005692
AA Change: S238*

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: S238*

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably null
Transcript: ENSMUST00000170371
AA Change: S238*

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: S238*

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	A	T	1: 165,510,297	E160V	probably damaging	Het
Ago1	C	A	4: 126,453,650	M435I	probably benign	Het
Apol7b	G	A	15: 77,423,710	A195V	probably damaging	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atg2b	C	T	12: 105,638,008	V1545I	probably benign	Het
Birc6	T	C	17: 74,602,971	V1453A	probably benign	Het
Brinp3	A	G	1: 146,901,404	R530G	possibly damaging	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Cdkl3	T	C	11: 52,032,495	V45A	probably benign	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Cyfip1	G	T	7: 55,899,957	R624L	probably null	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnah10	A	G	5: 124,731,466	N195S	probably benign	Het
Dnah9	T	C	11: 66,112,362	D872G	probably benign	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fmo1	A	T	1: 162,833,855	D286E	probably damaging	Het
Fmo4	A	T	1: 162,799,047	I310N	possibly damaging	Het
Gm13088	G	A	4: 143,654,142	T437I	probably damaging	Het
Hydin	A	T	8: 110,309,132	I152L	probably benign	Het
Itpr1	T	A	6: 108,493,755	C2214S	probably damaging	Het
Kcnq3	T	A	15: 66,028,680	D242V	probably damaging	Het
Klhl1	T	C	14: 96,517,908	D137G	probably benign	Het
Lama5	T	C	2: 180,178,603	D3282G	possibly damaging	Het
Lhx8	A	G	3: 154,316,762	L254S	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Matn4	A	T	2: 164,397,242	C232S	possibly damaging	Het
Mios	C	T	6: 8,226,865	R614C	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Muc6	T	A	7: 141,637,510	T2417S	possibly damaging	Het
Mycbp2	T	C	14: 103,144,338	H3612R	probably null	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
Myo7b	C	T	18: 31,977,043	S1122N	probably benign	Het
Myo9a	T	A	9: 59,815,301	F549I	probably damaging	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Neil1	A	G	9: 57,146,785	S84P	probably damaging	Het
Nfix	A	G	8: 84,727,175	I256T	probably damaging	Het
Nlrp4f	A	T	13: 65,194,408	D474E	probably benign	Het
Olfr203	T	G	16: 59,303,444	M98R	possibly damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pcnx	T	C	12: 81,995,314	V2240A	probably benign	Het
Per3	T	A	4: 151,018,885	Y530F	probably damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prpf8	T	A	11: 75,495,363	V946E	probably damaging	Het
Prrc1	G	T	18: 57,381,646	D312Y	probably damaging	Het
Prss54	C	T	8: 95,571,107	W45*	probably null	Het
Psg29	A	T	7: 17,210,696	N377I	probably benign	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Serpinb9c	C	T	13: 33,154,541	G125E	probably damaging	Het
Skint4	A	G	4: 112,119,868	T152A	probably benign	Het
Slc26a2	A	G	18: 61,198,578	C594R	possibly damaging	Het
Slc47a2	A	T	11: 61,328,526		probably null	Het
Ttc39d	A	G	17: 80,217,246	K445E	probably damaging	Het
Ttn	T	A	2: 76,764,520	E20394V	probably damaging	Het
Ugt2b36	A	G	5: 87,066,255	V510A	possibly damaging	Het
Usf1	T	C	1: 171,418,060	L291P	possibly damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Vmn1r172	A	C	7: 23,660,191	D167A	probably damaging	Het
Wnt10b	T	A	15: 98,774,347	Q163L	probably damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCCACTGTGATCCGAGAC -3'
(R):5'- AAACCCTGAGCTGTTCCTGC -3'

Sequencing Primer
(F):5'- CGAGACGGGGACAAGTTCC -3'
(R):5'- CCAGAAAGGTGCTCTGTGATAG -3'

Posted On

2014-10-16