Mutagenetix > Incidental Mutation

Incidental Mutation 'R2272:Prpf8'

242584

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

040272-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R2272 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75495363 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 946 (V946E)

Ref Sequence

ENSEMBL: ENSMUSP00000115635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: V1001E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: V1001E

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: V1001E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: V1001E

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131283
AA Change: V946E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850
AA Change: V946E

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133995

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	A	T	1: 165,510,297	E160V	probably damaging	Het
Ago1	C	A	4: 126,453,650	M435I	probably benign	Het
Apol7b	G	A	15: 77,423,710	A195V	probably damaging	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atg2b	C	T	12: 105,638,008	V1545I	probably benign	Het
Atp4a	C	A	7: 30,715,500	S238*	probably null	Het
Birc6	T	C	17: 74,602,971	V1453A	probably benign	Het
Brinp3	A	G	1: 146,901,404	R530G	possibly damaging	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Cdkl3	T	C	11: 52,032,495	V45A	probably benign	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Cyfip1	G	T	7: 55,899,957	R624L	probably null	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnah10	A	G	5: 124,731,466	N195S	probably benign	Het
Dnah9	T	C	11: 66,112,362	D872G	probably benign	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fmo1	A	T	1: 162,833,855	D286E	probably damaging	Het
Fmo4	A	T	1: 162,799,047	I310N	possibly damaging	Het
Gm13088	G	A	4: 143,654,142	T437I	probably damaging	Het
Hydin	A	T	8: 110,309,132	I152L	probably benign	Het
Itpr1	T	A	6: 108,493,755	C2214S	probably damaging	Het
Kcnq3	T	A	15: 66,028,680	D242V	probably damaging	Het
Klhl1	T	C	14: 96,517,908	D137G	probably benign	Het
Lama5	T	C	2: 180,178,603	D3282G	possibly damaging	Het
Lhx8	A	G	3: 154,316,762	L254S	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Matn4	A	T	2: 164,397,242	C232S	possibly damaging	Het
Mios	C	T	6: 8,226,865	R614C	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Muc6	T	A	7: 141,637,510	T2417S	possibly damaging	Het
Mycbp2	T	C	14: 103,144,338	H3612R	probably null	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
Myo7b	C	T	18: 31,977,043	S1122N	probably benign	Het
Myo9a	T	A	9: 59,815,301	F549I	probably damaging	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Neil1	A	G	9: 57,146,785	S84P	probably damaging	Het
Nfix	A	G	8: 84,727,175	I256T	probably damaging	Het
Nlrp4f	A	T	13: 65,194,408	D474E	probably benign	Het
Olfr203	T	G	16: 59,303,444	M98R	possibly damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pcnx	T	C	12: 81,995,314	V2240A	probably benign	Het
Per3	T	A	4: 151,018,885	Y530F	probably damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prrc1	G	T	18: 57,381,646	D312Y	probably damaging	Het
Prss54	C	T	8: 95,571,107	W45*	probably null	Het
Psg29	A	T	7: 17,210,696	N377I	probably benign	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Serpinb9c	C	T	13: 33,154,541	G125E	probably damaging	Het
Skint4	A	G	4: 112,119,868	T152A	probably benign	Het
Slc26a2	A	G	18: 61,198,578	C594R	possibly damaging	Het
Slc47a2	A	T	11: 61,328,526		probably null	Het
Ttc39d	A	G	17: 80,217,246	K445E	probably damaging	Het
Ttn	T	A	2: 76,764,520	E20394V	probably damaging	Het
Ugt2b36	A	G	5: 87,066,255	V510A	possibly damaging	Het
Usf1	T	C	1: 171,418,060	L291P	possibly damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Vmn1r172	A	C	7: 23,660,191	D167A	probably damaging	Het
Wnt10b	T	A	15: 98,774,347	Q163L	probably damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75496158	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75508548	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75493957	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75496044	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75503660	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75494782	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75494855	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75503431	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GCTGCTGAGGTTACTAGTCC -3'
(R):5'- TGCAGGCCTCTGATGATTCC -3'

Sequencing Primer
(F):5'- CTGCTGAGGTTACTAGTCCTGAAAAG -3'
(R):5'- CAGGCCTCTGATGATTCCATATGAG -3'

Posted On

2014-10-16