Mutagenetix > Incidental Mutations

Incidental Mutation 'R2272:Klhl1'

242591

Institutional Source

Beutler Lab

Gene Symbol

Klhl1

Ensembl Gene

ENSMUSG00000022076

Gene Name

kelch-like 1

Synonyms

MMRRC Submission

040272-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.232) question?

Stock #

R2272 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96102736-96519102 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96517908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 137 (D137G)

Ref Sequence

ENSEMBL: ENSMUSP00000022666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022666]

AlphaFold

Q9JI74

Predicted Effect

probably benign
Transcript: ENSMUST00000022666
AA Change: D137G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: D137G

Domain	Start	End	E-Value	Type
low complexity region	25	36	N/A	INTRINSIC
low complexity region	74	90	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
BTB	215	312	1.13e-28	SMART
BACK	317	418	5.03e-34	SMART
Kelch	463	509	8.86e-10	SMART
Kelch	510	556	1.04e-15	SMART
Kelch	557	603	6.76e-15	SMART
Kelch	604	650	2.23e-15	SMART
Kelch	651	703	3.09e-9	SMART
Kelch	704	750	3.43e-16	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	A	T	1: 165,510,297	E160V	probably damaging	Het
Ago1	C	A	4: 126,453,650	M435I	probably benign	Het
Apol7b	G	A	15: 77,423,710	A195V	probably damaging	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atg2b	C	T	12: 105,638,008	V1545I	probably benign	Het
Atp4a	C	A	7: 30,715,500	S238*	probably null	Het
Birc6	T	C	17: 74,602,971	V1453A	probably benign	Het
Brinp3	A	G	1: 146,901,404	R530G	possibly damaging	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Cdkl3	T	C	11: 52,032,495	V45A	probably benign	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Cyfip1	G	T	7: 55,899,957	R624L	probably null	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnah10	A	G	5: 124,731,466	N195S	probably benign	Het
Dnah9	T	C	11: 66,112,362	D872G	probably benign	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fmo1	A	T	1: 162,833,855	D286E	probably damaging	Het
Fmo4	A	T	1: 162,799,047	I310N	possibly damaging	Het
Gm13088	G	A	4: 143,654,142	T437I	probably damaging	Het
Hydin	A	T	8: 110,309,132	I152L	probably benign	Het
Itpr1	T	A	6: 108,493,755	C2214S	probably damaging	Het
Kcnq3	T	A	15: 66,028,680	D242V	probably damaging	Het
Lama5	T	C	2: 180,178,603	D3282G	possibly damaging	Het
Lhx8	A	G	3: 154,316,762	L254S	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Matn4	A	T	2: 164,397,242	C232S	possibly damaging	Het
Mios	C	T	6: 8,226,865	R614C	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Muc6	T	A	7: 141,637,510	T2417S	possibly damaging	Het
Mycbp2	T	C	14: 103,144,338	H3612R	probably null	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
Myo7b	C	T	18: 31,977,043	S1122N	probably benign	Het
Myo9a	T	A	9: 59,815,301	F549I	probably damaging	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Neil1	A	G	9: 57,146,785	S84P	probably damaging	Het
Nfix	A	G	8: 84,727,175	I256T	probably damaging	Het
Nlrp4f	A	T	13: 65,194,408	D474E	probably benign	Het
Olfr203	T	G	16: 59,303,444	M98R	possibly damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pcnx	T	C	12: 81,995,314	V2240A	probably benign	Het
Per3	T	A	4: 151,018,885	Y530F	probably damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prpf8	T	A	11: 75,495,363	V946E	probably damaging	Het
Prrc1	G	T	18: 57,381,646	D312Y	probably damaging	Het
Prss54	C	T	8: 95,571,107	W45*	probably null	Het
Psg29	A	T	7: 17,210,696	N377I	probably benign	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Serpinb9c	C	T	13: 33,154,541	G125E	probably damaging	Het
Skint4	A	G	4: 112,119,868	T152A	probably benign	Het
Slc26a2	A	G	18: 61,198,578	C594R	possibly damaging	Het
Slc47a2	A	T	11: 61,328,526		probably null	Het
Ttc39d	A	G	17: 80,217,246	K445E	probably damaging	Het
Ttn	T	A	2: 76,764,520	E20394V	probably damaging	Het
Ugt2b36	A	G	5: 87,066,255	V510A	possibly damaging	Het
Usf1	T	C	1: 171,418,060	L291P	possibly damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Vmn1r172	A	C	7: 23,660,191	D167A	probably damaging	Het
Wnt10b	T	A	15: 98,774,347	Q163L	probably damaging	Het

Other mutations in Klhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01573:Klhl1	APN	14	96201204	splice site	probably benign
IGL02055:Klhl1	APN	14	96280103	missense	possibly damaging	0.96
IGL02110:Klhl1	APN	14	96136603	missense	probably benign	0.27
IGL02216:Klhl1	APN	14	96123222	missense	probably benign	0.08
IGL02307:Klhl1	APN	14	96201373	missense	possibly damaging	0.68
IGL02538:Klhl1	APN	14	96240213	missense	probably benign	0.03
IGL02559:Klhl1	APN	14	96151960	missense	possibly damaging	0.95
IGL02682:Klhl1	APN	14	96201342	missense	possibly damaging	0.83
IGL03228:Klhl1	APN	14	96240327	missense	probably damaging	1.00
LCD18:Klhl1	UTSW	14	96317730	intron	probably benign
P0041:Klhl1	UTSW	14	96280211	missense	probably damaging	1.00
R0270:Klhl1	UTSW	14	96518344	start gained	probably benign
R0419:Klhl1	UTSW	14	96381789	missense	probably benign	0.30
R0938:Klhl1	UTSW	14	96152040	nonsense	probably null
R1465:Klhl1	UTSW	14	96240213	missense	probably benign	0.03
R1465:Klhl1	UTSW	14	96240213	missense	probably benign	0.03
R1590:Klhl1	UTSW	14	96368636	missense	probably damaging	1.00
R1597:Klhl1	UTSW	14	96201211	critical splice donor site	probably null
R1893:Klhl1	UTSW	14	96240206	critical splice donor site	probably null
R1928:Klhl1	UTSW	14	96346789	missense	probably benign	0.02
R3612:Klhl1	UTSW	14	96381770	critical splice donor site	probably null
R3852:Klhl1	UTSW	14	96280205	missense	probably benign	0.12
R3872:Klhl1	UTSW	14	96518179	missense	probably benign	0.03
R3874:Klhl1	UTSW	14	96518179	missense	probably benign	0.03
R3923:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R3925:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R3926:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R4151:Klhl1	UTSW	14	96518316	start codon destroyed	probably null	0.73
R4502:Klhl1	UTSW	14	96517846	missense	probably benign
R4536:Klhl1	UTSW	14	96136583	critical splice donor site	probably null
R4729:Klhl1	UTSW	14	96280148	missense	probably damaging	1.00
R4756:Klhl1	UTSW	14	96151966	missense	probably benign	0.39
R5001:Klhl1	UTSW	14	96136610	missense	probably damaging	0.96
R5022:Klhl1	UTSW	14	96136706	missense	probably benign	0.31
R5616:Klhl1	UTSW	14	96518293	missense	probably benign	0.44
R5634:Klhl1	UTSW	14	96240271	missense	probably damaging	0.96
R5700:Klhl1	UTSW	14	96518040	missense	probably benign
R5701:Klhl1	UTSW	14	96201380	missense	probably benign
R5934:Klhl1	UTSW	14	96123215	critical splice donor site	probably null
R5950:Klhl1	UTSW	14	96240354	missense	probably damaging	0.99
R6454:Klhl1	UTSW	14	96280091	missense	possibly damaging	0.66
R6496:Klhl1	UTSW	14	96240216	missense	probably benign	0.03
R6606:Klhl1	UTSW	14	96123222	missense	possibly damaging	0.52
R6644:Klhl1	UTSW	14	96517918	missense	probably benign
R6745:Klhl1	UTSW	14	96280002	critical splice donor site	probably null
R6919:Klhl1	UTSW	14	96136594	missense	probably benign	0.00
R7029:Klhl1	UTSW	14	96518196	missense	probably benign	0.01
R7195:Klhl1	UTSW	14	96280077	missense	probably benign	0.08
R7467:Klhl1	UTSW	14	96123277	missense	probably damaging	1.00
R7483:Klhl1	UTSW	14	96346868	missense	probably benign	0.09
R7650:Klhl1	UTSW	14	96346943	missense	probably damaging	0.96
R7817:Klhl1	UTSW	14	96136750	missense	possibly damaging	0.91
R8221:Klhl1	UTSW	14	96280110	missense	possibly damaging	0.69
R8444:Klhl1	UTSW	14	96517890	missense	probably benign
R8483:Klhl1	UTSW	14	96381934	missense	probably benign
R9100:Klhl1	UTSW	14	96346928	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGGCTGGCATCTATCTCAG -3'
(R):5'- TTTGAGCACTGGGGTCCTAG -3'

Sequencing Primer
(F):5'- AGGCTGGCATCTATCTCAGATTTTC -3'
(R):5'- GTCGGCTGCTCAAAAACCAGG -3'

Posted On

2014-10-16