Mutagenetix > Incidental Mutations

Incidental Mutation 'R2272:Carnmt1'

242609

Institutional Source

Beutler Lab

Gene Symbol

Carnmt1

Ensembl Gene

ENSMUSG00000024726

Gene Name

carnosine N-methyltransferase 1

Synonyms

2410127L17Rik

MMRRC Submission

040272-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R2272 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18670780-18704788 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18703370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 336 (L336P)

Ref Sequence

ENSEMBL: ENSMUSP00000025632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025632]

AlphaFold

Q80UY1

Predicted Effect

probably damaging
Transcript: ENSMUST00000025632
AA Change: L336P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025632
Gene: ENSMUSG00000024726
AA Change: L336P

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
N2227	135	400	2.56e-169	SMART

Meta Mutation Damage Score

0.9706

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts carnosine to anserine, a dipeptide found abundantly in skeletal muscle. The encoded protein can methylate other dipeptides as well. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	A	T	1: 165,510,297	E160V	probably damaging	Het
Ago1	C	A	4: 126,453,650	M435I	probably benign	Het
Apol7b	G	A	15: 77,423,710	A195V	probably damaging	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atg2b	C	T	12: 105,638,008	V1545I	probably benign	Het
Atp4a	C	A	7: 30,715,500	S238*	probably null	Het
Birc6	T	C	17: 74,602,971	V1453A	probably benign	Het
Brinp3	A	G	1: 146,901,404	R530G	possibly damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Cdkl3	T	C	11: 52,032,495	V45A	probably benign	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Cyfip1	G	T	7: 55,899,957	R624L	probably null	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnah10	A	G	5: 124,731,466	N195S	probably benign	Het
Dnah9	T	C	11: 66,112,362	D872G	probably benign	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fmo1	A	T	1: 162,833,855	D286E	probably damaging	Het
Fmo4	A	T	1: 162,799,047	I310N	possibly damaging	Het
Gm13088	G	A	4: 143,654,142	T437I	probably damaging	Het
Hydin	A	T	8: 110,309,132	I152L	probably benign	Het
Itpr1	T	A	6: 108,493,755	C2214S	probably damaging	Het
Kcnq3	T	A	15: 66,028,680	D242V	probably damaging	Het
Klhl1	T	C	14: 96,517,908	D137G	probably benign	Het
Lama5	T	C	2: 180,178,603	D3282G	possibly damaging	Het
Lhx8	A	G	3: 154,316,762	L254S	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Matn4	A	T	2: 164,397,242	C232S	possibly damaging	Het
Mios	C	T	6: 8,226,865	R614C	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Muc6	T	A	7: 141,637,510	T2417S	possibly damaging	Het
Mycbp2	T	C	14: 103,144,338	H3612R	probably null	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
Myo7b	C	T	18: 31,977,043	S1122N	probably benign	Het
Myo9a	T	A	9: 59,815,301	F549I	probably damaging	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Neil1	A	G	9: 57,146,785	S84P	probably damaging	Het
Nfix	A	G	8: 84,727,175	I256T	probably damaging	Het
Nlrp4f	A	T	13: 65,194,408	D474E	probably benign	Het
Olfr203	T	G	16: 59,303,444	M98R	possibly damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pcnx	T	C	12: 81,995,314	V2240A	probably benign	Het
Per3	T	A	4: 151,018,885	Y530F	probably damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prpf8	T	A	11: 75,495,363	V946E	probably damaging	Het
Prrc1	G	T	18: 57,381,646	D312Y	probably damaging	Het
Prss54	C	T	8: 95,571,107	W45*	probably null	Het
Psg29	A	T	7: 17,210,696	N377I	probably benign	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Serpinb9c	C	T	13: 33,154,541	G125E	probably damaging	Het
Skint4	A	G	4: 112,119,868	T152A	probably benign	Het
Slc26a2	A	G	18: 61,198,578	C594R	possibly damaging	Het
Slc47a2	A	T	11: 61,328,526		probably null	Het
Ttc39d	A	G	17: 80,217,246	K445E	probably damaging	Het
Ttn	T	A	2: 76,764,520	E20394V	probably damaging	Het
Ugt2b36	A	G	5: 87,066,255	V510A	possibly damaging	Het
Usf1	T	C	1: 171,418,060	L291P	possibly damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Vmn1r172	A	C	7: 23,660,191	D167A	probably damaging	Het
Wnt10b	T	A	15: 98,774,347	Q163L	probably damaging	Het

Other mutations in Carnmt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Carnmt1	APN	19	18703382	missense	possibly damaging	0.92
IGL01347:Carnmt1	APN	19	18691454	missense	probably benign	0.21
R0088:Carnmt1	UTSW	19	18677853	missense	probably benign	0.02
R1929:Carnmt1	UTSW	19	18703370	missense	probably damaging	1.00
R2270:Carnmt1	UTSW	19	18703370	missense	probably damaging	1.00
R2271:Carnmt1	UTSW	19	18703370	missense	probably damaging	1.00
R2519:Carnmt1	UTSW	19	18693711	missense	probably benign	0.41
R4597:Carnmt1	UTSW	19	18671087	missense	probably damaging	1.00
R5030:Carnmt1	UTSW	19	18691586	missense	possibly damaging	0.82
R5114:Carnmt1	UTSW	19	18677734	missense	probably damaging	1.00
R5933:Carnmt1	UTSW	19	18704105	missense	probably benign	0.00
R7262:Carnmt1	UTSW	19	18677864	missense	probably benign	0.33
R7394:Carnmt1	UTSW	19	18670837	start gained	probably benign
X0024:Carnmt1	UTSW	19	18677704	nonsense	probably null
X0065:Carnmt1	UTSW	19	18690309	missense	probably benign	0.00
Z1176:Carnmt1	UTSW	19	18679213	missense	possibly damaging	0.65
Z1176:Carnmt1	UTSW	19	18704090	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- GAAGATGTTTTCTTAGGTGAAACGG -3'
(R):5'- TTACCCAGGCCATTGTCAGC -3'

Sequencing Primer
(F):5'- AAACGGATTGGTTTTTGTTTCAGAG -3'
(R):5'- AGGCCATTGTCAGCTACCATTATTG -3'

Posted On

2014-10-16