Incidental Mutation 'R2272:Lipa'
ID242610
Institutional Source Beutler Lab
Gene Symbol Lipa
Ensembl Gene ENSMUSG00000024781
Gene Namelysosomal acid lipase A
SynonymsLal, Lip1, Lip-1
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34492318-34527474 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34510890 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 119 (R119*)
Ref Sequence ENSEMBL: ENSMUSP00000136967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049572] [ENSMUST00000178114]
Predicted Effect probably null
Transcript: ENSMUST00000049572
AA Change: R119*
SMART Domains Protein: ENSMUSP00000053270
Gene: ENSMUSG00000024781
AA Change: R119*

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.4e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.6e-11 PFAM
Pfam:Abhydrolase_6 80 382 2.2e-10 PFAM
Pfam:Abhydrolase_1 111 388 1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178114
AA Change: R119*
SMART Domains Protein: ENSMUSP00000136967
Gene: ENSMUSG00000024781
AA Change: R119*

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.3e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.5e-11 PFAM
Pfam:Abhydrolase_1 78 379 3.9e-31 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice show massive accumulation of triglycerides and cholesteryl esters in several organs, depletion of white and brown fat, hepatosplenomegaly, increased energy intake and plasma free fatty acid levels, insulin resistance, lung inflammation, alveolar destruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Lipa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Lipa APN 19 34494035 missense probably damaging 1.00
IGL02517:Lipa APN 19 34494122 missense possibly damaging 0.47
IGL02869:Lipa APN 19 34493997 missense probably benign 0.01
IGL02869:Lipa APN 19 34493971 utr 3 prime probably benign
buckboard UTSW 19 34524746 missense probably benign 0.04
Pashtun UTSW 19 34510928 missense probably damaging 1.00
suri UTSW 19 34501634 nonsense probably null
R0071:Lipa UTSW 19 34495082 missense probably damaging 1.00
R0244:Lipa UTSW 19 34501541 missense probably damaging 1.00
R1871:Lipa UTSW 19 34510928 missense probably damaging 1.00
R1929:Lipa UTSW 19 34510890 nonsense probably null
R2189:Lipa UTSW 19 34524799 missense probably benign 0.13
R2270:Lipa UTSW 19 34510890 nonsense probably null
R2271:Lipa UTSW 19 34510890 nonsense probably null
R4737:Lipa UTSW 19 34501634 nonsense probably null
R5713:Lipa UTSW 19 34523432 missense probably benign 0.00
R6381:Lipa UTSW 19 34524746 missense probably benign 0.04
R8338:Lipa UTSW 19 34494077 missense probably benign 0.01
RF012:Lipa UTSW 19 34509098 missense probably damaging 1.00
X0067:Lipa UTSW 19 34509020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTTTTAAATCCCTGACAAGC -3'
(R):5'- GCATCATGTTTGCTGAGAAGG -3'

Sequencing Primer
(F):5'- CCTGACAAGCTTTACAACTTTTCAAG -3'
(R):5'- TTGCTGAGAAGGTTGGAGCTAAC -3'
Posted On2014-10-16