Incidental Mutation 'R2273:Kifap3'
Institutional Source Beutler Lab
Gene Symbol Kifap3
Ensembl Gene ENSMUSG00000026585
Gene Namekinesin-associated protein 3
SynonymsSmg GDS, KAP3
MMRRC Submission 040273-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2273 (G1)
Quality Score225
Status Not validated
Chromosomal Location163779583-163917109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163868758 bp
Amino Acid Change Valine to Aspartic acid at position 652 (V652D)
Ref Sequence ENSEMBL: ENSMUSP00000076830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027877
AA Change: V652D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: V652D

KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077642
AA Change: V652D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: V652D

KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atp11b A G 3: 35,828,613 I606V probably benign Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Cdc42bpb C T 12: 111,302,167 E1200K probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Cfh C T 1: 140,102,825 V824M probably damaging Het
Ciapin1 A T 8: 94,831,787 V99E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Crim1 T C 17: 78,355,179 probably null Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat3 T C 9: 15,915,262 T4465A probably benign Het
Fdxacb1 A G 9: 50,772,021 E428G probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hivep2 T C 10: 14,132,443 M1595T probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Ift88 A G 14: 57,488,936 K684E possibly damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnc1 A G 7: 46,427,802 N343D probably damaging Het
Lrig1 A T 6: 94,608,143 D840E probably damaging Het
Lrrc7 A G 3: 158,187,059 S318P probably damaging Het
Map1b A C 13: 99,432,084 D1376E unknown Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mrc1 G A 2: 14,325,372 R1264Q probably damaging Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Olfr998 G T 2: 85,590,588 G16V probably damaging Het
Pcdhb4 C T 18: 37,308,926 L430F probably damaging Het
Ptpn2 T G 18: 67,677,802 M256L probably damaging Het
Rph3a C T 5: 120,973,304 R71H probably damaging Het
Rrm2b T A 15: 37,945,051 D148V possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
Sult1d1 T G 5: 87,556,028 N266T probably damaging Het
Tjp2 G T 19: 24,112,807 H624N probably benign Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vldlr A T 19: 27,248,015 T859S probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r94 T A 17: 18,257,331 M273L probably benign Het
Zc3h6 T C 2: 129,014,709 Y570H probably benign Het
Zhx2 A G 15: 57,823,169 S645G probably benign Het
Other mutations in Kifap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Kifap3 APN 1 163797270 missense probably damaging 1.00
IGL01655:Kifap3 APN 1 163796049 splice site probably benign
IGL02385:Kifap3 APN 1 163865444 nonsense probably null
IGL02517:Kifap3 APN 1 163825871 splice site probably benign
IGL02756:Kifap3 APN 1 163862028 missense probably damaging 0.98
IGL03034:Kifap3 APN 1 163888277 missense probably benign 0.05
IGL03230:Kifap3 APN 1 163825724 missense probably benign 0.02
IGL03270:Kifap3 APN 1 163848733 missense probably benign 0.18
IGL03340:Kifap3 APN 1 163829149 missense possibly damaging 0.94
R0207:Kifap3 UTSW 1 163883386 missense probably benign 0.00
R0333:Kifap3 UTSW 1 163797264 missense probably damaging 1.00
R0426:Kifap3 UTSW 1 163865552 splice site probably benign
R1467:Kifap3 UTSW 1 163829120 splice site probably benign
R1482:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R1547:Kifap3 UTSW 1 163794086 missense probably benign 0.01
R1704:Kifap3 UTSW 1 163829196 missense possibly damaging 0.50
R1724:Kifap3 UTSW 1 163783097 nonsense probably null
R1982:Kifap3 UTSW 1 163862022 nonsense probably null
R2233:Kifap3 UTSW 1 163856065 missense probably benign
R2274:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2275:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R3420:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3421:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3422:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R4194:Kifap3 UTSW 1 163915825 missense probably benign 0.10
R4260:Kifap3 UTSW 1 163862028 missense probably damaging 0.98
R4464:Kifap3 UTSW 1 163817895 missense probably benign 0.00
R4635:Kifap3 UTSW 1 163814435 missense probably damaging 1.00
R5090:Kifap3 UTSW 1 163856076 missense possibly damaging 0.89
R5426:Kifap3 UTSW 1 163779871 start codon destroyed probably null 0.30
R5868:Kifap3 UTSW 1 163865472 missense probably damaging 1.00
R6107:Kifap3 UTSW 1 163868769 missense possibly damaging 0.50
R6437:Kifap3 UTSW 1 163857526 missense probably damaging 0.99
R6744:Kifap3 UTSW 1 163848670 missense probably benign 0.00
R7051:Kifap3 UTSW 1 163794080 missense probably damaging 1.00
R7143:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R7143:Kifap3 UTSW 1 163856040 missense possibly damaging 0.66
R7216:Kifap3 UTSW 1 163795989 missense probably damaging 0.98
R7467:Kifap3 UTSW 1 163815833 missense probably benign
R7564:Kifap3 UTSW 1 163915768 missense probably damaging 1.00
R7939:Kifap3 UTSW 1 163815858 nonsense probably null
R8108:Kifap3 UTSW 1 163797362 missense probably damaging 0.99
R8496:Kifap3 UTSW 1 163829297 critical splice donor site probably null
U24488:Kifap3 UTSW 1 163783035 missense possibly damaging 0.64
Z1177:Kifap3 UTSW 1 163862062 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-16