Mutagenetix > Incidental Mutation

Incidental Mutation 'R2273:Mrc1'

242619

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

040273-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R2273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14330183 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1264 (R1264Q)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028045
AA Change: R1264Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: R1264Q

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146168

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	A	T	11: 99,728,667 (GRCm39)	C59S	possibly damaging	Het
Abca5	A	T	11: 110,166,107 (GRCm39)	N1556K	possibly damaging	Het
Ackr1	T	C	1: 173,160,052 (GRCm39)	N156D	probably benign	Het
Ank3	T	A	10: 69,786,772 (GRCm39)		probably null	Het
Arhgef7	T	A	8: 11,865,010 (GRCm39)	F374Y	possibly damaging	Het
Atp11b	A	G	3: 35,882,762 (GRCm39)	I606V	probably benign	Het
Atp6v1h	T	A	1: 5,187,699 (GRCm39)	D222E	probably damaging	Het
Bco1	G	A	8: 117,835,522 (GRCm39)		probably null	Het
Cacna1g	T	A	11: 94,306,762 (GRCm39)	E1842V	probably damaging	Het
Calhm3	T	A	19: 47,145,986 (GRCm39)	Q73L	probably damaging	Het
Cdc42bpb	C	T	12: 111,268,601 (GRCm39)	E1200K	probably damaging	Het
Cdr2	A	T	7: 120,557,732 (GRCm39)	H264Q	possibly damaging	Het
Cecr2	C	T	6: 120,733,702 (GRCm39)	S563L	probably benign	Het
Cfh	C	T	1: 140,030,563 (GRCm39)	V824M	probably damaging	Het
Ciapin1	A	T	8: 95,558,415 (GRCm39)	V99E	probably damaging	Het
Col9a2	C	G	4: 120,911,455 (GRCm39)	R599G	probably damaging	Het
Cpxm2	TGCAGCAGCAGCAGCAGCAG	TGCAGCAGCAGCAGCAG	7: 131,661,581 (GRCm39)		probably benign	Het
Crim1	T	C	17: 78,662,608 (GRCm39)		probably null	Het
D7Ertd443e	A	G	7: 133,871,930 (GRCm39)	S644P	probably damaging	Het
Dnlz	A	T	2: 26,241,483 (GRCm39)	C82S	probably damaging	Het
F11	T	C	8: 45,705,184 (GRCm39)	D119G	possibly damaging	Het
Fat3	T	C	9: 15,826,558 (GRCm39)	T4465A	probably benign	Het
Fdxacb1	A	G	9: 50,683,321 (GRCm39)	E428G	probably benign	Het
Fn1	C	T	1: 71,653,102 (GRCm39)	G1296R	probably null	Het
Gm11568	A	G	11: 99,749,070 (GRCm39)	S92G	unknown	Het
Gpr158	A	T	2: 21,831,674 (GRCm39)	M925L	probably benign	Het
Hivep2	T	C	10: 14,008,187 (GRCm39)	M1595T	probably benign	Het
Hoxd1	A	G	2: 74,594,501 (GRCm39)	K252R	probably damaging	Het
Ift88	A	G	14: 57,726,393 (GRCm39)	K684E	possibly damaging	Het
Iqck	G	A	7: 118,498,880 (GRCm39)	D173N	possibly damaging	Het
Kcnc1	A	G	7: 46,077,226 (GRCm39)	N343D	probably damaging	Het
Kifap3	T	A	1: 163,696,327 (GRCm39)	V652D	possibly damaging	Het
Lrig1	A	T	6: 94,585,124 (GRCm39)	D840E	probably damaging	Het
Lrrc7	A	G	3: 157,892,696 (GRCm39)	S318P	probably damaging	Het
Map1b	A	C	13: 99,568,592 (GRCm39)	D1376E	unknown	Het
Marchf1	T	A	8: 66,840,151 (GRCm39)	N311K	probably benign	Het
Mier2	T	C	10: 79,380,368 (GRCm39)	I321V	probably damaging	Het
Nrarp	T	C	2: 25,071,421 (GRCm39)	V100A	possibly damaging	Het
Nt5c1a	T	C	4: 123,109,873 (GRCm39)	F324S	probably damaging	Het
Odad2	C	A	18: 7,223,676 (GRCm39)	G456W	probably benign	Het
Or2t44	T	C	11: 58,677,492 (GRCm39)	V144A	probably benign	Het
Or5d41	A	G	2: 88,055,167 (GRCm39)	F70L	probably benign	Het
Or5g29	G	T	2: 85,420,932 (GRCm39)	G16V	probably damaging	Het
Or6c35	T	C	10: 129,169,326 (GRCm39)	I192T	probably benign	Het
Pcdhb4	C	T	18: 37,441,979 (GRCm39)	L430F	probably damaging	Het
Ptpn2	T	G	18: 67,810,872 (GRCm39)	M256L	probably damaging	Het
Rph3a	C	T	5: 121,111,367 (GRCm39)	R71H	probably damaging	Het
Rrm2b	T	A	15: 37,945,295 (GRCm39)	D148V	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,044,073 (GRCm39)	1814	probably null	Het
Slc12a3	T	A	8: 95,059,915 (GRCm39)	I187N	possibly damaging	Het
Slc46a1	T	G	11: 78,357,249 (GRCm39)	S101A	probably benign	Het
Sned1	T	A	1: 93,209,364 (GRCm39)		probably null	Het
Sult1d1	T	G	5: 87,703,887 (GRCm39)	N266T	probably damaging	Het
Tjp2	G	T	19: 24,090,171 (GRCm39)	H624N	probably benign	Het
Tmcc3	G	A	10: 94,414,777 (GRCm39)	V160I	probably damaging	Het
Tsr1	A	T	11: 74,795,653 (GRCm39)		probably null	Het
Tyrp1	A	T	4: 80,755,771 (GRCm39)	E180V	probably damaging	Het
Ubr3	T	C	2: 69,846,685 (GRCm39)	V1636A	probably benign	Het
Usp1	T	C	4: 98,818,079 (GRCm39)	L139P	probably damaging	Het
Vldlr	A	T	19: 27,225,415 (GRCm39)	T859S	probably damaging	Het
Vmn1r232	A	G	17: 21,134,465 (GRCm39)	L45P	probably benign	Het
Vmn2r94	T	A	17: 18,477,593 (GRCm39)	M273L	probably benign	Het
Zc3h6	T	C	2: 128,856,629 (GRCm39)	Y570H	probably benign	Het
Zhx2	A	G	15: 57,686,565 (GRCm39)	S645G	probably benign	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGTTGCAGCAACCCCAG -3'
(R):5'- TGTGGGAAATGATGTTGACCATTC -3'

Sequencing Primer
(F):5'- GCAGCAACCCCAGCTTTTATTTATG -3'
(R):5'- CACATATGGTTGGGAATGTAGCTCAC -3'

Posted On

2014-10-16