Incidental Mutation 'R2273:Zc3h6'
ID 242629
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
MMRRC Submission 040273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R2273 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 128967402-129018563 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129014709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 570 (Y570H)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110320
AA Change: Y570H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y570H

low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135186
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atp11b A G 3: 35,828,613 I606V probably benign Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Cdc42bpb C T 12: 111,302,167 E1200K probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Cfh C T 1: 140,102,825 V824M probably damaging Het
Ciapin1 A T 8: 94,831,787 V99E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Crim1 T C 17: 78,355,179 probably null Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat3 T C 9: 15,915,262 T4465A probably benign Het
Fdxacb1 A G 9: 50,772,021 E428G probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hivep2 T C 10: 14,132,443 M1595T probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Ift88 A G 14: 57,488,936 K684E possibly damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnc1 A G 7: 46,427,802 N343D probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Lrig1 A T 6: 94,608,143 D840E probably damaging Het
Lrrc7 A G 3: 158,187,059 S318P probably damaging Het
Map1b A C 13: 99,432,084 D1376E unknown Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mrc1 G A 2: 14,325,372 R1264Q probably damaging Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Olfr998 G T 2: 85,590,588 G16V probably damaging Het
Pcdhb4 C T 18: 37,308,926 L430F probably damaging Het
Ptpn2 T G 18: 67,677,802 M256L probably damaging Het
Rph3a C T 5: 120,973,304 R71H probably damaging Het
Rrm2b T A 15: 37,945,051 D148V possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
Sult1d1 T G 5: 87,556,028 N266T probably damaging Het
Tjp2 G T 19: 24,112,807 H624N probably benign Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vldlr A T 19: 27,248,015 T859S probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r94 T A 17: 18,257,331 M273L probably benign Het
Zhx2 A G 15: 57,823,169 S645G probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
R9076:Zc3h6 UTSW 2 129017176 nonsense probably null
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-16