Incidental Mutation 'R0172:Exosc10'
ID24263
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0172 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148565357 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 415 (S415P)
Ref Sequence ENSEMBL: ENSMUSP00000075401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect probably benign
Transcript: ENSMUST00000017408
AA Change: S415P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: S415P

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076022
AA Change: S415P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: S415P

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097781
AA Change: S415P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: S415P

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126897
Predicted Effect probably benign
Transcript: ENSMUST00000150723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 splice site probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
R7967:Exosc10 UTSW 4 148564664 missense probably damaging 1.00
R8225:Exosc10 UTSW 4 148565204 missense possibly damaging 0.86
R8477:Exosc10 UTSW 4 148565390 missense possibly damaging 0.71
R8510:Exosc10 UTSW 4 148564189 missense probably damaging 1.00
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCAGGGCAGCCCTTAC -3'
(R):5'- CTGGCATGGCAACTAAAGAAAAGCTATC -3'

Sequencing Primer
(F):5'- gccatccagcagtagcc -3'
(R):5'- TATCTTGAAAGTGACCAAGGTGGAC -3'
Posted On2013-04-16