Incidental Mutation 'R2273:Usp1'
ID242633
Institutional Source Beutler Lab
Gene Symbol Usp1
Ensembl Gene ENSMUSG00000028560
Gene Nameubiquitin specific peptidase 1
Synonyms
MMRRC Submission 040273-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R2273 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98923810-98935543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98929842 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 139 (L139P)
Ref Sequence ENSEMBL: ENSMUSP00000135496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030289] [ENSMUST00000091358] [ENSMUST00000125104] [ENSMUST00000169053]
Predicted Effect probably damaging
Transcript: ENSMUST00000030289
AA Change: L182P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030289
Gene: ENSMUSG00000028560
AA Change: L182P

DomainStartEndE-ValueType
Pfam:UCH 80 616 9.2e-35 PFAM
Pfam:UCH_1 415 618 1.3e-11 PFAM
Pfam:UCH 723 781 3.9e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091358
AA Change: L182P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088917
Gene: ENSMUSG00000028560
AA Change: L182P

DomainStartEndE-ValueType
Pfam:UCH 80 622 5e-39 PFAM
Pfam:UCH_1 346 613 2.8e-11 PFAM
low complexity region 765 779 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125104
AA Change: L139P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135496
Gene: ENSMUSG00000028560
AA Change: L139P

DomainStartEndE-ValueType
Pfam:UCH 37 150 4.1e-14 PFAM
Pfam:UCH_1 38 80 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169053
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ubiquitin-specific peptidase family. The encoded protein acts as a catalytic subunit in a heterodimeric deubiquitinating enzyme complex that deubiquitinates Fanconi anemia, complementation group D2, and plays a role in homologous recombination-mediated DNA repair. Disruption of this gene is associated with a Fanconi anemia-like phenotype and genomic instability. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 3, 12, and 15. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice have a high rate of postnatal lethality related to cyanosis. Male survivors are infertile while female survivors have reduced fertility. Both sexes have reduced number of gametes, are sensitive to ionizing radiation, and have decreased numbers of bone marrow cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atp11b A G 3: 35,828,613 I606V probably benign Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Cdc42bpb C T 12: 111,302,167 E1200K probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Cfh C T 1: 140,102,825 V824M probably damaging Het
Ciapin1 A T 8: 94,831,787 V99E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Crim1 T C 17: 78,355,179 probably null Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat3 T C 9: 15,915,262 T4465A probably benign Het
Fdxacb1 A G 9: 50,772,021 E428G probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hivep2 T C 10: 14,132,443 M1595T probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Ift88 A G 14: 57,488,936 K684E possibly damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnc1 A G 7: 46,427,802 N343D probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Lrig1 A T 6: 94,608,143 D840E probably damaging Het
Lrrc7 A G 3: 158,187,059 S318P probably damaging Het
Map1b A C 13: 99,432,084 D1376E unknown Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mrc1 G A 2: 14,325,372 R1264Q probably damaging Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Olfr998 G T 2: 85,590,588 G16V probably damaging Het
Pcdhb4 C T 18: 37,308,926 L430F probably damaging Het
Ptpn2 T G 18: 67,677,802 M256L probably damaging Het
Rph3a C T 5: 120,973,304 R71H probably damaging Het
Rrm2b T A 15: 37,945,051 D148V possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
Sult1d1 T G 5: 87,556,028 N266T probably damaging Het
Tjp2 G T 19: 24,112,807 H624N probably benign Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Vldlr A T 19: 27,248,015 T859S probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r94 T A 17: 18,257,331 M273L probably benign Het
Zc3h6 T C 2: 129,014,709 Y570H probably benign Het
Zhx2 A G 15: 57,823,169 S645G probably benign Het
Other mutations in Usp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Usp1 APN 4 98934581 unclassified probably null
IGL02692:Usp1 APN 4 98928960 missense probably benign 0.00
R1782:Usp1 UTSW 4 98934198 missense probably damaging 1.00
R1991:Usp1 UTSW 4 98934294 missense probably benign 0.00
R1992:Usp1 UTSW 4 98934294 missense probably benign 0.00
R2274:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2275:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R3750:Usp1 UTSW 4 98934120 unclassified probably null
R3886:Usp1 UTSW 4 98929736 missense probably damaging 1.00
R4014:Usp1 UTSW 4 98934702 missense probably damaging 1.00
R5141:Usp1 UTSW 4 98934209 missense probably damaging 1.00
R5304:Usp1 UTSW 4 98934618 missense probably benign
R5388:Usp1 UTSW 4 98931057 missense probably benign
R5709:Usp1 UTSW 4 98931123 missense probably damaging 0.99
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6592:Usp1 UTSW 4 98926519 missense possibly damaging 0.86
R6956:Usp1 UTSW 4 98931006 missense probably damaging 0.96
R7117:Usp1 UTSW 4 98928890 missense possibly damaging 0.59
R7396:Usp1 UTSW 4 98926451 intron probably benign
R7516:Usp1 UTSW 4 98934119 missense probably damaging 1.00
R7590:Usp1 UTSW 4 98934252 missense possibly damaging 0.67
R7828:Usp1 UTSW 4 98932307 missense probably damaging 1.00
R8050:Usp1 UTSW 4 98928913 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTGCTGTGAGACCAAGAAG -3'
(R):5'- GCATGAGTCTTTCGACAGAAAATG -3'

Sequencing Primer
(F):5'- AGAAGGAAAGAGGCACTTATTTAATG -3'
(R):5'- CTATGAGATGGGGCTTCAA -3'
Posted On2014-10-16