Mutagenetix > Incidental Mutation

Incidental Mutation 'R2273:Cecr2'

242641

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

040273-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 120756741 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 563 (S563L)

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]

AlphaFold

E9Q2Z1

Predicted Effect

probably benign
Transcript: ENSMUST00000100993
AA Change: S563L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: S563L

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112686
AA Change: S563L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: S563L

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124634

Predicted Effect

probably benign
Transcript: ENSMUST00000129803

SMART Domains

Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
coiled coil region	90	150	N/A	INTRINSIC
Pfam:Bromodomain	191	234	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143563

SMART Domains

Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	63	79	N/A	INTRINSIC
low complexity region	114	131	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	A	T	11: 99,837,841	C59S	possibly damaging	Het
Abca5	A	T	11: 110,275,281	N1556K	possibly damaging	Het
Ackr1	T	C	1: 173,332,485	N156D	probably benign	Het
Ank3	T	A	10: 69,950,942		probably null	Het
Arhgef7	T	A	8: 11,815,010	F374Y	possibly damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Atp11b	A	G	3: 35,828,613	I606V	probably benign	Het
Atp6v1h	T	A	1: 5,117,476	D222E	probably damaging	Het
Bco1	G	A	8: 117,108,783		probably null	Het
Cacna1g	T	A	11: 94,415,936	E1842V	probably damaging	Het
Calhm3	T	A	19: 47,157,547	Q73L	probably damaging	Het
Cdc42bpb	C	T	12: 111,302,167	E1200K	probably damaging	Het
Cdr2	A	T	7: 120,958,509	H264Q	possibly damaging	Het
Cfh	C	T	1: 140,102,825	V824M	probably damaging	Het
Ciapin1	A	T	8: 94,831,787	V99E	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Cpxm2	TGCAGCAGCAGCAGCAGCAG	TGCAGCAGCAGCAGCAG	7: 132,059,852		probably benign	Het
Crim1	T	C	17: 78,355,179		probably null	Het
D7Ertd443e	A	G	7: 134,270,201	S644P	probably damaging	Het
Dnlz	A	T	2: 26,351,471	C82S	probably damaging	Het
F11	T	C	8: 45,252,147	D119G	possibly damaging	Het
Fat3	T	C	9: 15,915,262	T4465A	probably benign	Het
Fdxacb1	A	G	9: 50,772,021	E428G	probably benign	Het
Fn1	C	T	1: 71,613,943	G1296R	probably null	Het
Gm11568	A	G	11: 99,858,244	S92G	unknown	Het
Gpr158	A	T	2: 21,826,863	M925L	probably benign	Het
Hivep2	T	C	10: 14,132,443	M1595T	probably benign	Het
Hoxd1	A	G	2: 74,764,157	K252R	probably damaging	Het
Ift88	A	G	14: 57,488,936	K684E	possibly damaging	Het
Iqck	G	A	7: 118,899,657	D173N	possibly damaging	Het
Kcnc1	A	G	7: 46,427,802	N343D	probably damaging	Het
Kifap3	T	A	1: 163,868,758	V652D	possibly damaging	Het
Lrig1	A	T	6: 94,608,143	D840E	probably damaging	Het
Lrrc7	A	G	3: 158,187,059	S318P	probably damaging	Het
Map1b	A	C	13: 99,432,084	D1376E	unknown	Het
March1	T	A	8: 66,387,499	N311K	probably benign	Het
Mier2	T	C	10: 79,544,534	I321V	probably damaging	Het
Mrc1	G	A	2: 14,325,372	R1264Q	probably damaging	Het
Nrarp	T	C	2: 25,181,409	V100A	possibly damaging	Het
Nt5c1a	T	C	4: 123,216,080	F324S	probably damaging	Het
Olfr1170	A	G	2: 88,224,823	F70L	probably benign	Het
Olfr314	T	C	11: 58,786,666	V144A	probably benign	Het
Olfr781	T	C	10: 129,333,457	I192T	probably benign	Het
Olfr998	G	T	2: 85,590,588	G16V	probably damaging	Het
Pcdhb4	C	T	18: 37,308,926	L430F	probably damaging	Het
Ptpn2	T	G	18: 67,677,802	M256L	probably damaging	Het
Rph3a	C	T	5: 120,973,304	R71H	probably damaging	Het
Rrm2b	T	A	15: 37,945,051	D148V	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc12a3	T	A	8: 94,333,287	I187N	possibly damaging	Het
Slc46a1	T	G	11: 78,466,423	S101A	probably benign	Het
Sned1	T	A	1: 93,281,642		probably null	Het
Sult1d1	T	G	5: 87,556,028	N266T	probably damaging	Het
Tjp2	G	T	19: 24,112,807	H624N	probably benign	Het
Tmcc3	G	A	10: 94,578,915	V160I	probably damaging	Het
Tsr1	A	T	11: 74,904,827		probably null	Het
Tyrp1	A	T	4: 80,837,534	E180V	probably damaging	Het
Ubr3	T	C	2: 70,016,341	V1636A	probably benign	Het
Usp1	T	C	4: 98,929,842	L139P	probably damaging	Het
Vldlr	A	T	19: 27,248,015	T859S	probably damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Vmn2r94	T	A	17: 18,257,331	M273L	probably benign	Het
Zc3h6	T	C	2: 129,014,709	Y570H	probably benign	Het
Zhx2	A	G	15: 57,823,169	S645G	probably benign	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	splice site	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
R8112:Cecr2	UTSW	6	120762214	missense	probably benign	0.00
R8289:Cecr2	UTSW	6	120758116	missense	probably benign	0.24
R8294:Cecr2	UTSW	6	120733786	missense	probably damaging	0.99
R8470:Cecr2	UTSW	6	120756933	missense	probably benign	0.21
R8697:Cecr2	UTSW	6	120733818	missense	probably damaging	1.00
R8887:Cecr2	UTSW	6	120738201	missense	probably damaging	1.00
R9371:Cecr2	UTSW	6	120762268	missense	probably benign	0.01
R9416:Cecr2	UTSW	6	120758577	missense
R9477:Cecr2	UTSW	6	120743782	critical splice acceptor site	probably null
R9588:Cecr2	UTSW	6	120756809	missense	possibly damaging	0.87
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGTGTAATATTTTCCAGAAGTAGC -3'
(R):5'- CTAGGCACCCTACCACAGTG -3'

Sequencing Primer
(F):5'- CCAAGATGTCTGACAATTTAGAGCG -3'
(R):5'- ACCCTACCACAGTGCAGGG -3'

Posted On

2014-10-16