Incidental Mutation 'R2273:F11'
ID242648
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Namecoagulation factor XI
SynonymsFXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
MMRRC Submission 040273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2273 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45241174-45262031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45252147 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 119 (D119G)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034064
AA Change: D119G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: D119G

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210622
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atp11b A G 3: 35,828,613 I606V probably benign Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Cdc42bpb C T 12: 111,302,167 E1200K probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Cfh C T 1: 140,102,825 V824M probably damaging Het
Ciapin1 A T 8: 94,831,787 V99E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Crim1 T C 17: 78,355,179 probably null Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Fat3 T C 9: 15,915,262 T4465A probably benign Het
Fdxacb1 A G 9: 50,772,021 E428G probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hivep2 T C 10: 14,132,443 M1595T probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Ift88 A G 14: 57,488,936 K684E possibly damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnc1 A G 7: 46,427,802 N343D probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Lrig1 A T 6: 94,608,143 D840E probably damaging Het
Lrrc7 A G 3: 158,187,059 S318P probably damaging Het
Map1b A C 13: 99,432,084 D1376E unknown Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mrc1 G A 2: 14,325,372 R1264Q probably damaging Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Olfr998 G T 2: 85,590,588 G16V probably damaging Het
Pcdhb4 C T 18: 37,308,926 L430F probably damaging Het
Ptpn2 T G 18: 67,677,802 M256L probably damaging Het
Rph3a C T 5: 120,973,304 R71H probably damaging Het
Rrm2b T A 15: 37,945,051 D148V possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
Sult1d1 T G 5: 87,556,028 N266T probably damaging Het
Tjp2 G T 19: 24,112,807 H624N probably benign Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vldlr A T 19: 27,248,015 T859S probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r94 T A 17: 18,257,331 M273L probably benign Het
Zc3h6 T C 2: 129,014,709 Y570H probably benign Het
Zhx2 A G 15: 57,823,169 S645G probably benign Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0225:F11 UTSW 8 45249077 missense probably benign 0.00
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2318:F11 UTSW 8 45248638 missense probably damaging 1.00
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2403:F11 UTSW 8 45248638 missense probably damaging 1.00
R2510:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2893:F11 UTSW 8 45248638 missense probably damaging 1.00
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6213:F11 UTSW 8 45241500 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7688:F11 UTSW 8 45250090 missense probably damaging 1.00
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
R8064:F11 UTSW 8 45245773 missense probably benign 0.01
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGAACCAGCGGTTTTCTTTCC -3'
(R):5'- GAATACCTCCTAGTGGAAGTGG -3'

Sequencing Primer
(F):5'- CCTGGGCAGGCTTATATCCAG -3'
(R):5'- TACCTCCTAGTGGAAGTGGGAATC -3'
Posted On2014-10-16