Incidental Mutation 'R2273:Ciapin1'
ID242651
Institutional Source Beutler Lab
Gene Symbol Ciapin1
Ensembl Gene ENSMUSG00000031781
Gene Namecytokine induced apoptosis inhibitor 1
Synonymsanamorsin, 2810413N20Rik
MMRRC Submission 040273-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2273 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94819804-94838358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94831787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 99 (V99E)
Ref Sequence ENSEMBL: ENSMUSP00000125451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034233] [ENSMUST00000161792] [ENSMUST00000162538]
Predicted Effect probably damaging
Transcript: ENSMUST00000034233
AA Change: V99E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034233
Gene: ENSMUSG00000031781
AA Change: V99E

DomainStartEndE-ValueType
Pfam:Methyltransf_11 18 95 4.7e-6 PFAM
Pfam:CIAPIN1 228 270 8e-8 PFAM
Pfam:CIAPIN1 262 301 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160301
Predicted Effect unknown
Transcript: ENSMUST00000161762
AA Change: V25E
SMART Domains Protein: ENSMUSP00000123794
Gene: ENSMUSG00000031781
AA Change: V25E

DomainStartEndE-ValueType
PDB:2LD4|A 1 171 9e-95 PDB
SCOP:d1khha_ 8 146 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161792
SMART Domains Protein: ENSMUSP00000125474
Gene: ENSMUSG00000031781

DomainStartEndE-ValueType
PDB:2LD4|A 10 76 3e-31 PDB
Pfam:CIAPIN1 125 158 1.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162120
Predicted Effect probably damaging
Transcript: ENSMUST00000162538
AA Change: V99E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125451
Gene: ENSMUSG00000031781
AA Change: V99E

DomainStartEndE-ValueType
Pfam:Methyltransf_11 18 95 4.7e-6 PFAM
Pfam:CIAPIN1 228 270 8e-8 PFAM
Pfam:CIAPIN1 262 301 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162589
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 (MIM 151430) or CASP (see MIM 147678) families. Expression of CIAPIN1 is dependent on growth factor stimulation (Shibayama et al., 2004 [PubMed 14970183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with erythropoietic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atp11b A G 3: 35,828,613 I606V probably benign Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Cdc42bpb C T 12: 111,302,167 E1200K probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Cfh C T 1: 140,102,825 V824M probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Crim1 T C 17: 78,355,179 probably null Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat3 T C 9: 15,915,262 T4465A probably benign Het
Fdxacb1 A G 9: 50,772,021 E428G probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hivep2 T C 10: 14,132,443 M1595T probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Ift88 A G 14: 57,488,936 K684E possibly damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnc1 A G 7: 46,427,802 N343D probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Lrig1 A T 6: 94,608,143 D840E probably damaging Het
Lrrc7 A G 3: 158,187,059 S318P probably damaging Het
Map1b A C 13: 99,432,084 D1376E unknown Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mrc1 G A 2: 14,325,372 R1264Q probably damaging Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Olfr998 G T 2: 85,590,588 G16V probably damaging Het
Pcdhb4 C T 18: 37,308,926 L430F probably damaging Het
Ptpn2 T G 18: 67,677,802 M256L probably damaging Het
Rph3a C T 5: 120,973,304 R71H probably damaging Het
Rrm2b T A 15: 37,945,051 D148V possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
Sult1d1 T G 5: 87,556,028 N266T probably damaging Het
Tjp2 G T 19: 24,112,807 H624N probably benign Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vldlr A T 19: 27,248,015 T859S probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r94 T A 17: 18,257,331 M273L probably benign Het
Zc3h6 T C 2: 129,014,709 Y570H probably benign Het
Zhx2 A G 15: 57,823,169 S645G probably benign Het
Other mutations in Ciapin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0070:Ciapin1 UTSW 8 94825219 missense possibly damaging 0.91
R0070:Ciapin1 UTSW 8 94825219 missense possibly damaging 0.91
R0218:Ciapin1 UTSW 8 94828310 missense probably damaging 0.98
R1980:Ciapin1 UTSW 8 94832533 missense probably benign 0.00
R2197:Ciapin1 UTSW 8 94829159 nonsense probably null
R4020:Ciapin1 UTSW 8 94829186 missense probably damaging 1.00
R5790:Ciapin1 UTSW 8 94825183 intron probably benign
R7236:Ciapin1 UTSW 8 94823710 missense
R8268:Ciapin1 UTSW 8 94831883 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTAGGTCAACCAGAGAGCAC -3'
(R):5'- ATTCTCCTGGGTGATGCCTG -3'

Sequencing Primer
(F):5'- AGAGAGCACATCTTCTCAGCTCTG -3'
(R):5'- CCTGTGGGAGATTGCTTCCCAG -3'
Posted On2014-10-16