Incidental Mutation 'R2273:Zhx2'
Institutional Source Beutler Lab
Gene Symbol Zhx2
Ensembl Gene ENSMUSG00000071757
Gene Namezinc fingers and homeoboxes 2
SynonymsAfr1, Raf, Afr-1
MMRRC Submission 040273-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R2273 (G1)
Quality Score225
Status Not validated
Chromosomal Location57694665-57839832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57823169 bp
Amino Acid Change Serine to Glycine at position 645 (S645G)
Ref Sequence ENSEMBL: ENSMUSP00000094164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096430]
Predicted Effect probably benign
Transcript: ENSMUST00000096430
AA Change: S645G

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000094164
Gene: ENSMUSG00000071757
AA Change: S645G

ZnF_C2H2 78 101 1.79e-2 SMART
ZnF_C2H2 110 133 1.99e0 SMART
low complexity region 191 209 N/A INTRINSIC
HOX 263 324 2.11e-3 SMART
HOX 439 501 4.94e-8 SMART
HOX 530 591 2.8e-7 SMART
HOX 628 690 3.09e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Alpha-fetoprotein levels in plasma decline precipitously after birth. This gene regulates a difference in adult level and rate of neonatal decrease of AFP. The BALB/cJ substrain carries a genetic variant allele determining a slow rate of decline to adultlevel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atp11b A G 3: 35,828,613 I606V probably benign Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Cdc42bpb C T 12: 111,302,167 E1200K probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Cfh C T 1: 140,102,825 V824M probably damaging Het
Ciapin1 A T 8: 94,831,787 V99E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Crim1 T C 17: 78,355,179 probably null Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat3 T C 9: 15,915,262 T4465A probably benign Het
Fdxacb1 A G 9: 50,772,021 E428G probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hivep2 T C 10: 14,132,443 M1595T probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Ift88 A G 14: 57,488,936 K684E possibly damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnc1 A G 7: 46,427,802 N343D probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Lrig1 A T 6: 94,608,143 D840E probably damaging Het
Lrrc7 A G 3: 158,187,059 S318P probably damaging Het
Map1b A C 13: 99,432,084 D1376E unknown Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mrc1 G A 2: 14,325,372 R1264Q probably damaging Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Olfr998 G T 2: 85,590,588 G16V probably damaging Het
Pcdhb4 C T 18: 37,308,926 L430F probably damaging Het
Ptpn2 T G 18: 67,677,802 M256L probably damaging Het
Rph3a C T 5: 120,973,304 R71H probably damaging Het
Rrm2b T A 15: 37,945,051 D148V possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
Sult1d1 T G 5: 87,556,028 N266T probably damaging Het
Tjp2 G T 19: 24,112,807 H624N probably benign Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vldlr A T 19: 27,248,015 T859S probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r94 T A 17: 18,257,331 M273L probably benign Het
Zc3h6 T C 2: 129,014,709 Y570H probably benign Het
Other mutations in Zhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Zhx2 APN 15 57822870 missense probably damaging 1.00
IGL00694:Zhx2 APN 15 57821760 missense probably benign
IGL02407:Zhx2 APN 15 57823406 missense probably benign 0.00
IGL02456:Zhx2 APN 15 57823639 missense possibly damaging 0.72
IGL02737:Zhx2 APN 15 57822267 missense probably damaging 1.00
Gross UTSW 15 57822728 missense probably damaging 1.00
Lange UTSW 15 57822176 missense probably damaging 1.00
IGL03050:Zhx2 UTSW 15 57822833 missense possibly damaging 0.90
R0010:Zhx2 UTSW 15 57821274 missense possibly damaging 0.92
R0105:Zhx2 UTSW 15 57822695 missense probably damaging 1.00
R0420:Zhx2 UTSW 15 57821840 missense probably damaging 1.00
R0799:Zhx2 UTSW 15 57821313 missense probably benign
R0800:Zhx2 UTSW 15 57822728 missense probably damaging 1.00
R2497:Zhx2 UTSW 15 57823155 missense possibly damaging 0.48
R4198:Zhx2 UTSW 15 57821729 missense probably benign
R4372:Zhx2 UTSW 15 57823301 missense probably benign 0.02
R4992:Zhx2 UTSW 15 57823587 missense probably damaging 0.96
R4994:Zhx2 UTSW 15 57821359 missense probably benign 0.03
R5085:Zhx2 UTSW 15 57822693 missense probably damaging 1.00
R5141:Zhx2 UTSW 15 57821786 missense probably benign 0.00
R5470:Zhx2 UTSW 15 57823074 missense possibly damaging 0.76
R5659:Zhx2 UTSW 15 57822308 missense probably benign
R5710:Zhx2 UTSW 15 57821470 nonsense probably null
R6171:Zhx2 UTSW 15 57823206 missense probably damaging 1.00
R7181:Zhx2 UTSW 15 57823350 missense probably benign
R7215:Zhx2 UTSW 15 57823643 missense probably benign
R7273:Zhx2 UTSW 15 57823428 missense probably benign 0.09
R7575:Zhx2 UTSW 15 57823262 missense probably damaging 1.00
R7662:Zhx2 UTSW 15 57822176 missense probably damaging 1.00
R7883:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
R7966:Zhx2 UTSW 15 57821667 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-16