Mutagenetix > Incidental Mutation

Incidental Mutation 'R2273:Crim1'

242679

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

040273-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 78355179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

AlphaFold

Q9JLL0

Predicted Effect

probably null
Transcript: ENSMUST00000112498

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	A	T	11: 99,837,841	C59S	possibly damaging	Het
Abca5	A	T	11: 110,275,281	N1556K	possibly damaging	Het
Ackr1	T	C	1: 173,332,485	N156D	probably benign	Het
Ank3	T	A	10: 69,950,942		probably null	Het
Arhgef7	T	A	8: 11,815,010	F374Y	possibly damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Atp11b	A	G	3: 35,828,613	I606V	probably benign	Het
Atp6v1h	T	A	1: 5,117,476	D222E	probably damaging	Het
Bco1	G	A	8: 117,108,783		probably null	Het
Cacna1g	T	A	11: 94,415,936	E1842V	probably damaging	Het
Calhm3	T	A	19: 47,157,547	Q73L	probably damaging	Het
Cdc42bpb	C	T	12: 111,302,167	E1200K	probably damaging	Het
Cdr2	A	T	7: 120,958,509	H264Q	possibly damaging	Het
Cecr2	C	T	6: 120,756,741	S563L	probably benign	Het
Cfh	C	T	1: 140,102,825	V824M	probably damaging	Het
Ciapin1	A	T	8: 94,831,787	V99E	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Cpxm2	TGCAGCAGCAGCAGCAGCAG	TGCAGCAGCAGCAGCAG	7: 132,059,852		probably benign	Het
D7Ertd443e	A	G	7: 134,270,201	S644P	probably damaging	Het
Dnlz	A	T	2: 26,351,471	C82S	probably damaging	Het
F11	T	C	8: 45,252,147	D119G	possibly damaging	Het
Fat3	T	C	9: 15,915,262	T4465A	probably benign	Het
Fdxacb1	A	G	9: 50,772,021	E428G	probably benign	Het
Fn1	C	T	1: 71,613,943	G1296R	probably null	Het
Gm11568	A	G	11: 99,858,244	S92G	unknown	Het
Gpr158	A	T	2: 21,826,863	M925L	probably benign	Het
Hivep2	T	C	10: 14,132,443	M1595T	probably benign	Het
Hoxd1	A	G	2: 74,764,157	K252R	probably damaging	Het
Ift88	A	G	14: 57,488,936	K684E	possibly damaging	Het
Iqck	G	A	7: 118,899,657	D173N	possibly damaging	Het
Kcnc1	A	G	7: 46,427,802	N343D	probably damaging	Het
Kifap3	T	A	1: 163,868,758	V652D	possibly damaging	Het
Lrig1	A	T	6: 94,608,143	D840E	probably damaging	Het
Lrrc7	A	G	3: 158,187,059	S318P	probably damaging	Het
Map1b	A	C	13: 99,432,084	D1376E	unknown	Het
March1	T	A	8: 66,387,499	N311K	probably benign	Het
Mier2	T	C	10: 79,544,534	I321V	probably damaging	Het
Mrc1	G	A	2: 14,325,372	R1264Q	probably damaging	Het
Nrarp	T	C	2: 25,181,409	V100A	possibly damaging	Het
Nt5c1a	T	C	4: 123,216,080	F324S	probably damaging	Het
Olfr1170	A	G	2: 88,224,823	F70L	probably benign	Het
Olfr314	T	C	11: 58,786,666	V144A	probably benign	Het
Olfr781	T	C	10: 129,333,457	I192T	probably benign	Het
Olfr998	G	T	2: 85,590,588	G16V	probably damaging	Het
Pcdhb4	C	T	18: 37,308,926	L430F	probably damaging	Het
Ptpn2	T	G	18: 67,677,802	M256L	probably damaging	Het
Rph3a	C	T	5: 120,973,304	R71H	probably damaging	Het
Rrm2b	T	A	15: 37,945,051	D148V	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc12a3	T	A	8: 94,333,287	I187N	possibly damaging	Het
Slc46a1	T	G	11: 78,466,423	S101A	probably benign	Het
Sned1	T	A	1: 93,281,642		probably null	Het
Sult1d1	T	G	5: 87,556,028	N266T	probably damaging	Het
Tjp2	G	T	19: 24,112,807	H624N	probably benign	Het
Tmcc3	G	A	10: 94,578,915	V160I	probably damaging	Het
Tsr1	A	T	11: 74,904,827		probably null	Het
Tyrp1	A	T	4: 80,837,534	E180V	probably damaging	Het
Ubr3	T	C	2: 70,016,341	V1636A	probably benign	Het
Usp1	T	C	4: 98,929,842	L139P	probably damaging	Het
Vldlr	A	T	19: 27,248,015	T859S	probably damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Vmn2r94	T	A	17: 18,257,331	M273L	probably benign	Het
Zc3h6	T	C	2: 129,014,709	Y570H	probably benign	Het
Zhx2	A	G	15: 57,823,169	S645G	probably benign	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8961:Crim1	UTSW	17	78372688	missense	possibly damaging	0.65
R8971:Crim1	UTSW	17	78345980	missense	possibly damaging	0.89
R9245:Crim1	UTSW	17	78344442	missense	probably damaging	1.00
R9250:Crim1	UTSW	17	78370042	missense	probably benign
R9401:Crim1	UTSW	17	78350865	frame shift	probably null
R9402:Crim1	UTSW	17	78350865	frame shift	probably null
R9644:Crim1	UTSW	17	78280068	missense	probably damaging	1.00
R9702:Crim1	UTSW	17	78374087	missense	probably damaging	1.00
R9710:Crim1	UTSW	17	78303075	nonsense	probably null
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- CACATCCCATAATGAGAGCGTGC -3'
(R):5'- TTCACGCATCCATCTTGGGG -3'

Sequencing Primer
(F):5'- TGCCTAGCTACTGCAGGAATG -3'
(R):5'- CATCTTGGGGGCACAGCTTTC -3'

Posted On

2014-10-16