Incidental Mutation 'R2273:Pcdhb4'
ID 242681
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Name protocadherin beta 4
Synonyms PcdhbD, Pcdhb5A
MMRRC Submission 040273-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2273 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 37440508-37444225 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37441979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 430 (L430F)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91XZ6
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056712
AA Change: L430F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: L430F

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,728,667 (GRCm39) C59S possibly damaging Het
Abca5 A T 11: 110,166,107 (GRCm39) N1556K possibly damaging Het
Ackr1 T C 1: 173,160,052 (GRCm39) N156D probably benign Het
Ank3 T A 10: 69,786,772 (GRCm39) probably null Het
Arhgef7 T A 8: 11,865,010 (GRCm39) F374Y possibly damaging Het
Atp11b A G 3: 35,882,762 (GRCm39) I606V probably benign Het
Atp6v1h T A 1: 5,187,699 (GRCm39) D222E probably damaging Het
Bco1 G A 8: 117,835,522 (GRCm39) probably null Het
Cacna1g T A 11: 94,306,762 (GRCm39) E1842V probably damaging Het
Calhm3 T A 19: 47,145,986 (GRCm39) Q73L probably damaging Het
Cdc42bpb C T 12: 111,268,601 (GRCm39) E1200K probably damaging Het
Cdr2 A T 7: 120,557,732 (GRCm39) H264Q possibly damaging Het
Cecr2 C T 6: 120,733,702 (GRCm39) S563L probably benign Het
Cfh C T 1: 140,030,563 (GRCm39) V824M probably damaging Het
Ciapin1 A T 8: 95,558,415 (GRCm39) V99E probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 131,661,581 (GRCm39) probably benign Het
Crim1 T C 17: 78,662,608 (GRCm39) probably null Het
D7Ertd443e A G 7: 133,871,930 (GRCm39) S644P probably damaging Het
Dnlz A T 2: 26,241,483 (GRCm39) C82S probably damaging Het
F11 T C 8: 45,705,184 (GRCm39) D119G possibly damaging Het
Fat3 T C 9: 15,826,558 (GRCm39) T4465A probably benign Het
Fdxacb1 A G 9: 50,683,321 (GRCm39) E428G probably benign Het
Fn1 C T 1: 71,653,102 (GRCm39) G1296R probably null Het
Gm11568 A G 11: 99,749,070 (GRCm39) S92G unknown Het
Gpr158 A T 2: 21,831,674 (GRCm39) M925L probably benign Het
Hivep2 T C 10: 14,008,187 (GRCm39) M1595T probably benign Het
Hoxd1 A G 2: 74,594,501 (GRCm39) K252R probably damaging Het
Ift88 A G 14: 57,726,393 (GRCm39) K684E possibly damaging Het
Iqck G A 7: 118,498,880 (GRCm39) D173N possibly damaging Het
Kcnc1 A G 7: 46,077,226 (GRCm39) N343D probably damaging Het
Kifap3 T A 1: 163,696,327 (GRCm39) V652D possibly damaging Het
Lrig1 A T 6: 94,585,124 (GRCm39) D840E probably damaging Het
Lrrc7 A G 3: 157,892,696 (GRCm39) S318P probably damaging Het
Map1b A C 13: 99,568,592 (GRCm39) D1376E unknown Het
Marchf1 T A 8: 66,840,151 (GRCm39) N311K probably benign Het
Mier2 T C 10: 79,380,368 (GRCm39) I321V probably damaging Het
Mrc1 G A 2: 14,330,183 (GRCm39) R1264Q probably damaging Het
Nrarp T C 2: 25,071,421 (GRCm39) V100A possibly damaging Het
Nt5c1a T C 4: 123,109,873 (GRCm39) F324S probably damaging Het
Odad2 C A 18: 7,223,676 (GRCm39) G456W probably benign Het
Or2t44 T C 11: 58,677,492 (GRCm39) V144A probably benign Het
Or5d41 A G 2: 88,055,167 (GRCm39) F70L probably benign Het
Or5g29 G T 2: 85,420,932 (GRCm39) G16V probably damaging Het
Or6c35 T C 10: 129,169,326 (GRCm39) I192T probably benign Het
Ptpn2 T G 18: 67,810,872 (GRCm39) M256L probably damaging Het
Rph3a C T 5: 121,111,367 (GRCm39) R71H probably damaging Het
Rrm2b T A 15: 37,945,295 (GRCm39) D148V possibly damaging Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc12a3 T A 8: 95,059,915 (GRCm39) I187N possibly damaging Het
Slc46a1 T G 11: 78,357,249 (GRCm39) S101A probably benign Het
Sned1 T A 1: 93,209,364 (GRCm39) probably null Het
Sult1d1 T G 5: 87,703,887 (GRCm39) N266T probably damaging Het
Tjp2 G T 19: 24,090,171 (GRCm39) H624N probably benign Het
Tmcc3 G A 10: 94,414,777 (GRCm39) V160I probably damaging Het
Tsr1 A T 11: 74,795,653 (GRCm39) probably null Het
Tyrp1 A T 4: 80,755,771 (GRCm39) E180V probably damaging Het
Ubr3 T C 2: 69,846,685 (GRCm39) V1636A probably benign Het
Usp1 T C 4: 98,818,079 (GRCm39) L139P probably damaging Het
Vldlr A T 19: 27,225,415 (GRCm39) T859S probably damaging Het
Vmn1r232 A G 17: 21,134,465 (GRCm39) L45P probably benign Het
Vmn2r94 T A 17: 18,477,593 (GRCm39) M273L probably benign Het
Zc3h6 T C 2: 128,856,629 (GRCm39) Y570H probably benign Het
Zhx2 A G 15: 57,686,565 (GRCm39) S645G probably benign Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37,442,969 (GRCm39) missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37,441,566 (GRCm39) missense probably benign
IGL01325:Pcdhb4 APN 18 37,442,676 (GRCm39) missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37,441,803 (GRCm39) missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37,442,067 (GRCm39) missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37,442,057 (GRCm39) missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37,440,735 (GRCm39) missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37,442,721 (GRCm39) missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37,443,030 (GRCm39) missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37,441,569 (GRCm39) missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37,441,938 (GRCm39) missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37,442,268 (GRCm39) missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37,441,263 (GRCm39) missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37,440,795 (GRCm39) missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37,441,764 (GRCm39) missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37,442,938 (GRCm39) nonsense probably null
R0893:Pcdhb4 UTSW 18 37,442,423 (GRCm39) splice site probably null
R1932:Pcdhb4 UTSW 18 37,442,594 (GRCm39) missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37,441,921 (GRCm39) missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37,441,788 (GRCm39) missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37,442,367 (GRCm39) missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37,441,901 (GRCm39) missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37,443,017 (GRCm39) missense probably benign
R4606:Pcdhb4 UTSW 18 37,441,705 (GRCm39) missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37,441,553 (GRCm39) missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37,441,452 (GRCm39) missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37,442,979 (GRCm39) missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37,440,819 (GRCm39) missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37,442,034 (GRCm39) missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37,442,042 (GRCm39) missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37,442,619 (GRCm39) missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37,441,482 (GRCm39) missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37,441,074 (GRCm39) missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37,442,625 (GRCm39) missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37,441,835 (GRCm39) missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37,442,292 (GRCm39) missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37,441,222 (GRCm39) missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37,442,328 (GRCm39) missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37,442,505 (GRCm39) missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37,442,602 (GRCm39) missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37,442,667 (GRCm39) missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37,442,293 (GRCm39) missense probably damaging 1.00
R8080:Pcdhb4 UTSW 18 37,442,349 (GRCm39) missense probably benign 0.42
R8087:Pcdhb4 UTSW 18 37,441,717 (GRCm39) missense probably damaging 1.00
R8115:Pcdhb4 UTSW 18 37,442,453 (GRCm39) missense probably damaging 0.99
R8697:Pcdhb4 UTSW 18 37,441,832 (GRCm39) missense probably benign 0.15
R8815:Pcdhb4 UTSW 18 37,442,055 (GRCm39) missense probably damaging 1.00
R9008:Pcdhb4 UTSW 18 37,440,714 (GRCm39) missense probably benign
R9225:Pcdhb4 UTSW 18 37,441,695 (GRCm39) missense possibly damaging 0.68
R9278:Pcdhb4 UTSW 18 37,441,925 (GRCm39) missense possibly damaging 0.61
R9299:Pcdhb4 UTSW 18 37,442,264 (GRCm39) missense probably benign 0.02
R9390:Pcdhb4 UTSW 18 37,442,781 (GRCm39) missense possibly damaging 0.80
R9582:Pcdhb4 UTSW 18 37,441,417 (GRCm39) missense probably damaging 1.00
R9686:Pcdhb4 UTSW 18 37,442,943 (GRCm39) missense probably damaging 0.98
R9721:Pcdhb4 UTSW 18 37,442,905 (GRCm39) missense possibly damaging 0.70
Z1177:Pcdhb4 UTSW 18 37,442,966 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAACTCCCCAGAGACTGTCG -3'
(R):5'- CAGCGTTGATGGAGATGAGC -3'

Sequencing Primer
(F):5'- CCAGAGACTGTCGTTGCAG -3'
(R):5'- AGGAGAGGGCCAGCTGC -3'
Posted On 2014-10-16