Incidental Mutation 'R2275:Ackr1'
ID 242694
Institutional Source Beutler Lab
Gene Symbol Ackr1
Ensembl Gene ENSMUSG00000037872
Gene Name atypical chemokine receptor 1 (Duffy blood group)
Synonyms Darc, ESTM35, Dfy, FY, CCBP1, CD234
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2275 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173331886-173333750 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 173332485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 156 (N156D)
Ref Sequence ENSEMBL: ENSMUSP00000045134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000038227] [ENSMUST00000111220] [ENSMUST00000194046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005470
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038227
AA Change: N156D

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000045134
Gene: ENSMUSG00000037872
AA Change: N156D

DomainStartEndE-ValueType
SCOP:d1l9ha_ 26 317 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111220
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136540
Predicted Effect probably benign
Transcript: ENSMUST00000194046
SMART Domains Protein: ENSMUSP00000141765
Gene: ENSMUSG00000037872

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194298
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are healthy, but erythrocytes lack CXC and CC chemokine-binding activity, such that when challenged with LPS result in increased inflammatory infiltrates in lung and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Ackr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ackr1 APN 1 173332829 missense probably benign 0.23
R0479:Ackr1 UTSW 1 173332145 missense probably benign 0.02
R1664:Ackr1 UTSW 1 173332866 missense probably benign 0.36
R1713:Ackr1 UTSW 1 173332349 missense probably benign 0.38
R2273:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R2274:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R4469:Ackr1 UTSW 1 173332545 splice site probably null
R5871:Ackr1 UTSW 1 173332073 missense probably damaging 0.99
R6523:Ackr1 UTSW 1 173332553 critical splice donor site probably null
R7062:Ackr1 UTSW 1 173332115 missense possibly damaging 0.68
R7751:Ackr1 UTSW 1 173332212 missense probably damaging 0.96
R8234:Ackr1 UTSW 1 173332015 missense probably benign 0.12
R8477:Ackr1 UTSW 1 173332188 missense probably damaging 1.00
R8697:Ackr1 UTSW 1 173332208 missense probably damaging 0.96
R8738:Ackr1 UTSW 1 173332385 missense probably damaging 0.97
R8851:Ackr1 UTSW 1 173332116 missense probably benign 0.23
R9131:Ackr1 UTSW 1 173332508 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCTCAGTGCTATCTTCAGC -3'
(R):5'- TCTGGCAGAGTTAGCAGTGG -3'

Sequencing Primer
(F):5'- CTTGGCTGCCAAAAGAGTCG -3'
(R):5'- GGCAGTGCCCTGTTCAG -3'
Posted On 2014-10-16