Incidental Mutation 'R2275:Kcnh1'
ID242695
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 1
SynonymsKv10.1, Eag1, ether a go-go
MMRRC Submission 040274-MU
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R2275 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location192190774-192510159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 192337521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 358 (V358G)
Ref Sequence ENSEMBL: ENSMUSP00000106468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]
Predicted Effect probably benign
Transcript: ENSMUST00000078470
AA Change: V385G

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: V385G

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110844
AA Change: V358G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: V358G

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192506038 missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R1997:Kcnh1 UTSW 1 192276935 missense probably damaging 0.99
R2254:Kcnh1 UTSW 1 192505414 intron probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3552:Kcnh1 UTSW 1 192238766 missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 192277140 missense probably benign
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R6972:Kcnh1 UTSW 1 192276836 missense probably damaging 1.00
R7199:Kcnh1 UTSW 1 192337605 missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7799:Kcnh1 UTSW 1 192434875 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACTTAATGGCCGTGGTGGG -3'
(R):5'- CGAGGAGATGTAGACAGAGTTCTTG -3'

Sequencing Primer
(F):5'- TGGGGTGGAGCCATAGC -3'
(R):5'- AGACAGAGTTCTTGCTTGGCCC -3'
Posted On2014-10-16