Mutagenetix > Incidental Mutations

Incidental Mutation 'R2275:Setx'

242700

Institutional Source

Beutler Lab

Gene Symbol

Setx

Ensembl Gene

ENSMUSG00000043535

Gene Name

senataxin

Synonyms

A930037J23Rik, Als4

MMRRC Submission

040274-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2275 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

29124181-29182471 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GTGGCT to GT at 29154061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

at position 1814 (1814)

Ref Sequence

ENSEMBL: ENSMUSP00000051492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061578]

AlphaFold

A2AKX3

Predicted Effect

probably null
Transcript: ENSMUST00000061578
AA Change: 1814

SMART Domains

Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: 1814

Domain	Start	End	E-Value	Type
low complexity region	864	876	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC
low complexity region	1058	1079	N/A	INTRINSIC
low complexity region	1575	1594	N/A	INTRINSIC
Pfam:AAA_11	1909	2194	1.9e-68	PFAM
Pfam:AAA_19	1924	2015	2.9e-11	PFAM
Pfam:AAA_12	2201	2402	1.1e-54	PFAM
low complexity region	2499	2516	N/A	INTRINSIC
low complexity region	2576	2587	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135992

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	A	G	3: 108,542,503	N33D	possibly damaging	Het
2300003K06Rik	A	T	11: 99,837,841	C59S	possibly damaging	Het
Abca5	A	T	11: 110,275,281	N1556K	possibly damaging	Het
Ackr1	T	C	1: 173,332,485	N156D	probably benign	Het
Aco2	C	T	15: 81,895,264	R57C	probably benign	Het
Adamtsl3	A	T	7: 82,606,558	S1593C	probably benign	Het
Adgrb2	G	A	4: 130,006,854	G333D	probably damaging	Het
Arhgef7	T	A	8: 11,815,010	F374Y	possibly damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Atxn7	T	A	14: 14,013,268	M62K	possibly damaging	Het
C87436	G	A	6: 86,445,600	R52H	probably damaging	Het
Cacna1g	T	A	11: 94,415,936	E1842V	probably damaging	Het
Cdh4	T	C	2: 179,890,847	S701P	probably damaging	Het
Cdr2	A	T	7: 120,958,509	H264Q	possibly damaging	Het
Cecr2	C	T	6: 120,756,741	S563L	probably benign	Het
Col12a1	A	T	9: 79,635,427	V2352E	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csad	G	T	15: 102,187,122	R167S	probably damaging	Het
Dnlz	A	T	2: 26,351,471	C82S	probably damaging	Het
Ehmt2	T	A	17: 34,910,715	N951K	possibly damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Enpp2	A	C	15: 54,897,794	Y221D	probably damaging	Het
Exoc3l	A	T	8: 105,290,447		probably null	Het
F11	T	C	8: 45,252,147	D119G	possibly damaging	Het
Faiml	T	C	9: 99,229,559	Y149C	probably benign	Het
Fn1	C	T	1: 71,613,943	G1296R	probably null	Het
Glg1	A	T	8: 111,168,721	Y819*	probably null	Het
Gm11568	A	G	11: 99,858,244	S92G	unknown	Het
Gm28042	A	C	2: 120,036,829	Q465P	probably damaging	Het
Gpatch1	A	T	7: 35,288,678	S678T	probably benign	Het
Gpr158	A	T	2: 21,826,863	M925L	probably benign	Het
Hecw1	T	C	13: 14,346,068	T195A	probably benign	Het
Hoxd1	A	G	2: 74,764,157	K252R	probably damaging	Het
Iqck	G	A	7: 118,899,657	D173N	possibly damaging	Het
Kcnh1	T	G	1: 192,337,521	V358G	probably damaging	Het
Kifap3	T	A	1: 163,868,758	V652D	possibly damaging	Het
Knl1	C	A	2: 119,072,281	Q1488K	probably damaging	Het
Map4k1	T	A	7: 29,001,957	H729Q	probably damaging	Het
March1	T	A	8: 66,387,499	N311K	probably benign	Het
Mypn	A	G	10: 63,131,069	F943L	probably damaging	Het
Nkpd1	A	G	7: 19,523,897	I534V	probably benign	Het
Nrarp	T	C	2: 25,181,409	V100A	possibly damaging	Het
Nt5c1a	T	C	4: 123,216,080	F324S	probably damaging	Het
Ntrk2	T	A	13: 58,861,351	Y319N	probably damaging	Het
Olfr1170	A	G	2: 88,224,823	F70L	probably benign	Het
Parg	A	G	14: 32,295,238	D384G	probably damaging	Het
Pde7b	T	A	10: 20,400,419	*460L	probably null	Het
Pigr	G	T	1: 130,846,470	V396L	probably benign	Het
Pkhd1	A	G	1: 20,200,849	I3160T	possibly damaging	Het
Ppl	T	C	16: 5,094,552	S722G	probably benign	Het
Ppp1r26	A	G	2: 28,452,701	E781G	possibly damaging	Het
Rptor	T	A	11: 119,756,322	C246*	probably null	Het
Rusc2	G	A	4: 43,416,260	R522H	probably damaging	Het
Senp7	T	C	16: 56,184,783	S927P	probably damaging	Het
Serpinb6d	A	T	13: 33,671,428	M362L	probably benign	Het
Slc12a3	T	A	8: 94,333,287	I187N	possibly damaging	Het
Slc46a1	T	G	11: 78,466,423	S101A	probably benign	Het
Slc4a8	A	G	15: 100,807,402	M830V	probably benign	Het
Slco4a1	T	C	2: 180,464,736	L237P	possibly damaging	Het
Sned1	T	A	1: 93,281,642		probably null	Het
Tia1	A	G	6: 86,427,677	N298S	probably benign	Het
Tsr1	A	T	11: 74,904,827		probably null	Het
Ttc6	G	A	12: 57,702,298	V1339I	probably benign	Het
Tyrp1	A	T	4: 80,837,534	E180V	probably damaging	Het
Ubr3	T	C	2: 70,016,341	V1636A	probably benign	Het
Usp1	T	C	4: 98,929,842	L139P	probably damaging	Het
Vmn1r228	A	G	17: 20,776,545	L237P	probably damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Vmn2r2	T	C	3: 64,116,509	R884G	probably benign	Het
Vmn2r60	T	A	7: 42,136,827	Y351*	probably null	Het
Zbtb7a	G	A	10: 81,144,997	V342I	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,752	N127K	probably damaging	Het

Other mutations in Setx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00688:Setx	APN	2	29148445	missense	possibly damaging	0.50
IGL00806:Setx	APN	2	29127026	missense	probably damaging	1.00
IGL01346:Setx	APN	2	29144809	missense	probably damaging	1.00
IGL01623:Setx	APN	2	29163009	missense	possibly damaging	0.70
IGL02351:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02358:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02378:Setx	APN	2	29173726	splice site	probably benign
IGL02388:Setx	APN	2	29173653	missense	probably damaging	1.00
IGL02408:Setx	APN	2	29133930	missense	probably damaging	1.00
IGL02425:Setx	APN	2	29148408	missense	probably benign	0.00
IGL03023:Setx	APN	2	29145902	missense	probably benign	0.02
IGL03351:Setx	APN	2	29161799	missense	probably benign	0.25
Addison	UTSW	2	29158905	missense	probably damaging	1.00
dallas	UTSW	2	29154061	frame shift	probably null
Denton	UTSW	2	29145060	missense	possibly damaging	0.81
doggie	UTSW	2	29164550	missense	probably damaging	1.00
Irving	UTSW	2	29139221	missense	probably damaging	0.99
G1Funyon:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
IGL03014:Setx	UTSW	2	29139411	missense	probably damaging	1.00
PIT4403001:Setx	UTSW	2	29133955	missense	probably damaging	1.00
R0027:Setx	UTSW	2	29139221	missense	probably damaging	0.99
R0031:Setx	UTSW	2	29176929	missense	probably benign	0.02
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0092:Setx	UTSW	2	29146293	missense	probably benign	0.00
R0193:Setx	UTSW	2	29179673	missense	probably benign	0.21
R0281:Setx	UTSW	2	29179643	missense	probably benign	0.00
R0401:Setx	UTSW	2	29166289	nonsense	probably null
R0413:Setx	UTSW	2	29139278	missense	probably damaging	1.00
R0517:Setx	UTSW	2	29157133	missense	probably benign	0.00
R0536:Setx	UTSW	2	29158248	missense	possibly damaging	0.46
R0617:Setx	UTSW	2	29146807	missense	possibly damaging	0.86
R1183:Setx	UTSW	2	29180092	missense	probably benign
R1331:Setx	UTSW	2	29179686	missense	probably benign
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1482:Setx	UTSW	2	29162992	missense	probably damaging	0.99
R1599:Setx	UTSW	2	29140373	missense	probably benign	0.04
R1663:Setx	UTSW	2	29126905	missense	probably damaging	1.00
R1909:Setx	UTSW	2	29163009	missense	possibly damaging	0.70
R2117:Setx	UTSW	2	29130301	missense	probably benign	0.01
R2207:Setx	UTSW	2	29154061	frame shift	probably null
R2221:Setx	UTSW	2	29154061	frame shift	probably null
R2223:Setx	UTSW	2	29148537	missense	possibly damaging	0.89
R2223:Setx	UTSW	2	29154061	frame shift	probably null
R2273:Setx	UTSW	2	29154061	frame shift	probably null
R2274:Setx	UTSW	2	29154061	frame shift	probably null
R2309:Setx	UTSW	2	29158904	missense	probably damaging	1.00
R2328:Setx	UTSW	2	29154060	frame shift	probably null
R2328:Setx	UTSW	2	29154061	frame shift	probably null
R2329:Setx	UTSW	2	29154061	frame shift	probably null
R2331:Setx	UTSW	2	29154061	frame shift	probably null
R2332:Setx	UTSW	2	29154061	frame shift	probably null
R2429:Setx	UTSW	2	29179898	missense	probably benign	0.00
R2438:Setx	UTSW	2	29154061	frame shift	probably null
R2439:Setx	UTSW	2	29154061	frame shift	probably null
R2496:Setx	UTSW	2	29144801	missense	probably benign	0.11
R2858:Setx	UTSW	2	29154061	frame shift	probably null
R2859:Setx	UTSW	2	29154061	frame shift	probably null
R2884:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2885:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2886:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2915:Setx	UTSW	2	29172324	missense	probably damaging	0.99
R2921:Setx	UTSW	2	29154060	small deletion	probably benign
R2921:Setx	UTSW	2	29154061	frame shift	probably null
R2923:Setx	UTSW	2	29154061	frame shift	probably null
R3426:Setx	UTSW	2	29154061	frame shift	probably null
R3609:Setx	UTSW	2	29154061	frame shift	probably null
R3610:Setx	UTSW	2	29154061	frame shift	probably null
R3731:Setx	UTSW	2	29154061	frame shift	probably null
R3813:Setx	UTSW	2	29154061	frame shift	probably null
R3835:Setx	UTSW	2	29145060	missense	possibly damaging	0.81
R3871:Setx	UTSW	2	29145741	missense	probably damaging	0.98
R4013:Setx	UTSW	2	29154061	frame shift	probably null
R4014:Setx	UTSW	2	29154061	frame shift	probably null
R4015:Setx	UTSW	2	29154061	frame shift	probably null
R4017:Setx	UTSW	2	29154061	frame shift	probably null
R4246:Setx	UTSW	2	29154061	frame shift	probably null
R4248:Setx	UTSW	2	29154061	frame shift	probably null
R4297:Setx	UTSW	2	29154061	frame shift	probably null
R4298:Setx	UTSW	2	29154061	frame shift	probably null
R4539:Setx	UTSW	2	29179748	missense	probably benign	0.14
R4590:Setx	UTSW	2	29144809	missense	probably damaging	1.00
R4632:Setx	UTSW	2	29148615	missense	probably benign	0.23
R4782:Setx	UTSW	2	29144046	missense	probably damaging	0.99
R4801:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4802:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4975:Setx	UTSW	2	29164550	missense	probably damaging	1.00
R5040:Setx	UTSW	2	29139338	missense	probably damaging	1.00
R5133:Setx	UTSW	2	29180081	missense	probably benign	0.02
R5208:Setx	UTSW	2	29166367	missense	possibly damaging	0.63
R5237:Setx	UTSW	2	29146983	missense	probably benign	0.00
R5248:Setx	UTSW	2	29148418	missense	probably benign	0.26
R5288:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5385:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5387:Setx	UTSW	2	29147594	missense	probably benign	0.00
R5407:Setx	UTSW	2	29145474	missense	probably benign	0.00
R5685:Setx	UTSW	2	29171280	missense	probably damaging	1.00
R6110:Setx	UTSW	2	29140290	missense	probably damaging	1.00
R6136:Setx	UTSW	2	29148027	missense	probably benign	0.01
R6310:Setx	UTSW	2	29176935	missense	possibly damaging	0.57
R6328:Setx	UTSW	2	29174462	intron	probably benign
R6358:Setx	UTSW	2	29171348	missense	possibly damaging	0.79
R6384:Setx	UTSW	2	29173558	missense	probably damaging	1.00
R6400:Setx	UTSW	2	29130274	missense	probably damaging	0.97
R6572:Setx	UTSW	2	29173694	missense	possibly damaging	0.63
R6662:Setx	UTSW	2	29158114	missense	probably damaging	0.97
R6898:Setx	UTSW	2	29148108	missense	probably benign	0.00
R7188:Setx	UTSW	2	29148172	missense	probably benign	0.02
R7332:Setx	UTSW	2	29146626	missense	probably benign	0.00
R7357:Setx	UTSW	2	29130301	missense	probably benign	0.01
R7556:Setx	UTSW	2	29146493	missense	possibly damaging	0.88
R7646:Setx	UTSW	2	29177549	missense	possibly damaging	0.94
R7802:Setx	UTSW	2	29147021	missense	probably benign	0.02
R7810:Setx	UTSW	2	29148651	missense	probably benign	0.43
R7831:Setx	UTSW	2	29157108	missense	probably damaging	1.00
R7831:Setx	UTSW	2	29179854	missense	possibly damaging	0.75
R7843:Setx	UTSW	2	29173569	missense	probably damaging	1.00
R7850:Setx	UTSW	2	29147418	missense	probably damaging	1.00
R7858:Setx	UTSW	2	29161550	missense	probably damaging	1.00
R8121:Setx	UTSW	2	29145034	missense	possibly damaging	0.93
R8284:Setx	UTSW	2	29145336	missense	possibly damaging	0.46
R8301:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
R8752:Setx	UTSW	2	29158980	missense	probably damaging	0.97
R8785:Setx	UTSW	2	29145263	missense	probably damaging	1.00
R8871:Setx	UTSW	2	29148102	missense	probably benign	0.11
R8927:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R8928:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R9182:Setx	UTSW	2	29171287	missense	probably damaging	1.00
R9334:Setx	UTSW	2	29154020	nonsense	probably null
R9335:Setx	UTSW	2	29145951	missense	probably benign	0.00
X0066:Setx	UTSW	2	29147879	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTATTGGCTTAGGTCACCCTTCC -3'
(R):5'- GCTCTAAGGGGATCCAGCATATC -3'

Sequencing Primer
(F):5'- ACTTGCTAAACAGCTTCACC -3'
(R):5'- CAGGCACCTGCACTTGTATG -3'

Posted On

2014-10-16