Incidental Mutation 'R2275:Gm28042'
ID242705
Institutional Source Beutler Lab
Gene Symbol Gm28042
Ensembl Gene ENSMUSG00000033852
Gene Namepredicted gene, 28042
Synonyms
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R2275 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120027493-120043033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120036829 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 465 (Q465P)
Ref Sequence ENSEMBL: ENSMUSP00000117535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044675] [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]
Predicted Effect probably benign
Transcript: ENSMUST00000044675
SMART Domains Protein: ENSMUSP00000041220
Gene: ENSMUSG00000098789

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 307 4.31e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125805
SMART Domains Protein: ENSMUSP00000122869
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
Pfam:Cupin_8 2 62 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126150
AA Change: Q242P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: Q242P

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129685
AA Change: Q465P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: Q465P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156805
AA Change: Q465P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852
AA Change: Q465P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Gm28042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Gm28042 APN 2 120030356 missense probably damaging 1.00
IGL01148:Gm28042 APN 2 120039038 missense possibly damaging 0.74
IGL02005:Gm28042 APN 2 120034634 missense possibly damaging 0.95
IGL02237:Gm28042 APN 2 120039899 missense possibly damaging 0.61
IGL02539:Gm28042 APN 2 120035221 missense probably damaging 1.00
IGL02747:Gm28042 APN 2 120031394 missense probably damaging 1.00
IGL02825:Gm28042 APN 2 120031644 missense probably damaging 0.99
IGL02998:Gm28042 APN 2 120040154 missense possibly damaging 0.70
IGL03057:Gm28042 APN 2 120032156 missense probably damaging 1.00
IGL03084:Gm28042 APN 2 120040505 missense probably benign 0.08
IGL03160:Gm28042 APN 2 120035828 missense possibly damaging 0.94
PIT4520001:Gm28042 UTSW 2 120039667 nonsense probably null
R0147:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R0270:Gm28042 UTSW 2 120041592 missense probably benign 0.06
R0315:Gm28042 UTSW 2 120039057 missense probably damaging 1.00
R1421:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R1589:Gm28042 UTSW 2 120041406 missense probably benign 0.05
R1599:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R1656:Gm28042 UTSW 2 120038889 missense probably damaging 1.00
R1718:Gm28042 UTSW 2 120036391 missense possibly damaging 0.78
R1969:Gm28042 UTSW 2 120041615 makesense probably null
R2164:Gm28042 UTSW 2 120036748 missense probably benign 0.01
R3976:Gm28042 UTSW 2 120036756 missense probably benign 0.11
R4483:Gm28042 UTSW 2 120035840 missense possibly damaging 0.68
R4614:Gm28042 UTSW 2 120041158 missense probably damaging 0.99
R4802:Gm28042 UTSW 2 120042054 utr 3 prime probably benign
R4976:Gm28042 UTSW 2 120034643 missense probably damaging 1.00
R5119:Gm28042 UTSW 2 120034643 missense probably damaging 1.00
R5177:Gm28042 UTSW 2 120041601 unclassified probably null
R5340:Gm28042 UTSW 2 120041448 missense probably benign
R5861:Gm28042 UTSW 2 120034635 missense probably damaging 1.00
R6641:Gm28042 UTSW 2 120039683 missense probably damaging 1.00
R7187:Gm28042 UTSW 2 120039695 missense probably damaging 1.00
R7488:Gm28042 UTSW 2 120039957 missense probably benign 0.00
R7699:Gm28042 UTSW 2 120039716 missense possibly damaging 0.81
R7700:Gm28042 UTSW 2 120039716 missense possibly damaging 0.81
X0019:Gm28042 UTSW 2 120039658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGCCACAGGGAGTTAG -3'
(R):5'- AGTGGCTCCTGGAAACCATG -3'

Sequencing Primer
(F):5'- CCACAGGGAGTTAGTTGGTG -3'
(R):5'- TGGCTCCTGGAAACCATGAGTAC -3'
Posted On2014-10-16