Mutagenetix > Incidental Mutations

Incidental Mutation 'R2275:Rusc2'

242710

Institutional Source

Beutler Lab

Gene Symbol

Rusc2

Ensembl Gene

ENSMUSG00000035969

Gene Name

RUN and SH3 domain containing 2

Synonyms

MMRRC Submission

040274-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R2275 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43381979-43427088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43416260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 522 (R522H)

Ref Sequence

ENSEMBL: ENSMUSP00000133715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000098106] [ENSMUST00000125399] [ENSMUST00000131668] [ENSMUST00000135216] [ENSMUST00000136360] [ENSMUST00000139198] [ENSMUST00000144911] [ENSMUST00000149221] [ENSMUST00000152322] [ENSMUST00000173682]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035645
AA Change: R522H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: R522H

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098106
AA Change: R522H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: R522H

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125393

Predicted Effect

probably benign
Transcript: ENSMUST00000125399

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131037

Predicted Effect

probably damaging
Transcript: ENSMUST00000131668
AA Change: R522H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: R522H

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135216

Predicted Effect

probably benign
Transcript: ENSMUST00000136360

SMART Domains

Protein: ENSMUSP00000123431
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139198

SMART Domains

Protein: ENSMUSP00000121528
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146710

Predicted Effect

probably benign
Transcript: ENSMUST00000149221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150066

Predicted Effect

probably benign
Transcript: ENSMUST00000152322

Predicted Effect

probably damaging
Transcript: ENSMUST00000173682
AA Change: R522H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969
AA Change: R522H

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	685	703	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	A	G	3: 108,542,503	N33D	possibly damaging	Het
2300003K06Rik	A	T	11: 99,837,841	C59S	possibly damaging	Het
Abca5	A	T	11: 110,275,281	N1556K	possibly damaging	Het
Ackr1	T	C	1: 173,332,485	N156D	probably benign	Het
Aco2	C	T	15: 81,895,264	R57C	probably benign	Het
Adamtsl3	A	T	7: 82,606,558	S1593C	probably benign	Het
Adgrb2	G	A	4: 130,006,854	G333D	probably damaging	Het
Arhgef7	T	A	8: 11,815,010	F374Y	possibly damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Atxn7	T	A	14: 14,013,268	M62K	possibly damaging	Het
C87436	G	A	6: 86,445,600	R52H	probably damaging	Het
Cacna1g	T	A	11: 94,415,936	E1842V	probably damaging	Het
Cdh4	T	C	2: 179,890,847	S701P	probably damaging	Het
Cdr2	A	T	7: 120,958,509	H264Q	possibly damaging	Het
Cecr2	C	T	6: 120,756,741	S563L	probably benign	Het
Col12a1	A	T	9: 79,635,427	V2352E	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csad	G	T	15: 102,187,122	R167S	probably damaging	Het
Dnlz	A	T	2: 26,351,471	C82S	probably damaging	Het
Ehmt2	T	A	17: 34,910,715	N951K	possibly damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Enpp2	A	C	15: 54,897,794	Y221D	probably damaging	Het
Exoc3l	A	T	8: 105,290,447		probably null	Het
F11	T	C	8: 45,252,147	D119G	possibly damaging	Het
Faiml	T	C	9: 99,229,559	Y149C	probably benign	Het
Fn1	C	T	1: 71,613,943	G1296R	probably null	Het
Glg1	A	T	8: 111,168,721	Y819*	probably null	Het
Gm11568	A	G	11: 99,858,244	S92G	unknown	Het
Gm28042	A	C	2: 120,036,829	Q465P	probably damaging	Het
Gpatch1	A	T	7: 35,288,678	S678T	probably benign	Het
Gpr158	A	T	2: 21,826,863	M925L	probably benign	Het
Hecw1	T	C	13: 14,346,068	T195A	probably benign	Het
Hoxd1	A	G	2: 74,764,157	K252R	probably damaging	Het
Iqck	G	A	7: 118,899,657	D173N	possibly damaging	Het
Kcnh1	T	G	1: 192,337,521	V358G	probably damaging	Het
Kifap3	T	A	1: 163,868,758	V652D	possibly damaging	Het
Knl1	C	A	2: 119,072,281	Q1488K	probably damaging	Het
Map4k1	T	A	7: 29,001,957	H729Q	probably damaging	Het
March1	T	A	8: 66,387,499	N311K	probably benign	Het
Mypn	A	G	10: 63,131,069	F943L	probably damaging	Het
Nkpd1	A	G	7: 19,523,897	I534V	probably benign	Het
Nrarp	T	C	2: 25,181,409	V100A	possibly damaging	Het
Nt5c1a	T	C	4: 123,216,080	F324S	probably damaging	Het
Ntrk2	T	A	13: 58,861,351	Y319N	probably damaging	Het
Olfr1170	A	G	2: 88,224,823	F70L	probably benign	Het
Parg	A	G	14: 32,295,238	D384G	probably damaging	Het
Pde7b	T	A	10: 20,400,419	*460L	probably null	Het
Pigr	G	T	1: 130,846,470	V396L	probably benign	Het
Pkhd1	A	G	1: 20,200,849	I3160T	possibly damaging	Het
Ppl	T	C	16: 5,094,552	S722G	probably benign	Het
Ppp1r26	A	G	2: 28,452,701	E781G	possibly damaging	Het
Rptor	T	A	11: 119,756,322	C246*	probably null	Het
Senp7	T	C	16: 56,184,783	S927P	probably damaging	Het
Serpinb6d	A	T	13: 33,671,428	M362L	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc12a3	T	A	8: 94,333,287	I187N	possibly damaging	Het
Slc46a1	T	G	11: 78,466,423	S101A	probably benign	Het
Slc4a8	A	G	15: 100,807,402	M830V	probably benign	Het
Slco4a1	T	C	2: 180,464,736	L237P	possibly damaging	Het
Sned1	T	A	1: 93,281,642		probably null	Het
Tia1	A	G	6: 86,427,677	N298S	probably benign	Het
Tsr1	A	T	11: 74,904,827		probably null	Het
Ttc6	G	A	12: 57,702,298	V1339I	probably benign	Het
Tyrp1	A	T	4: 80,837,534	E180V	probably damaging	Het
Ubr3	T	C	2: 70,016,341	V1636A	probably benign	Het
Usp1	T	C	4: 98,929,842	L139P	probably damaging	Het
Vmn1r228	A	G	17: 20,776,545	L237P	probably damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Vmn2r2	T	C	3: 64,116,509	R884G	probably benign	Het
Vmn2r60	T	A	7: 42,136,827	Y351*	probably null	Het
Zbtb7a	G	A	10: 81,144,997	V342I	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,752	N127K	probably damaging	Het

Other mutations in Rusc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Rusc2	APN	4	43426116	missense	probably damaging	0.97
IGL01474:Rusc2	APN	4	43416434	missense	probably damaging	0.98
IGL01541:Rusc2	APN	4	43415840	missense	probably benign	0.08
IGL01628:Rusc2	APN	4	43425729	missense	probably damaging	1.00
IGL01969:Rusc2	APN	4	43415738	missense	probably benign	0.02
IGL02030:Rusc2	APN	4	43416095	missense	possibly damaging	0.86
IGL02079:Rusc2	APN	4	43425668	missense	probably benign
IGL02115:Rusc2	APN	4	43426136	splice site	probably benign
IGL02122:Rusc2	APN	4	43421685	missense	possibly damaging	0.67
IGL02350:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02357:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02437:Rusc2	APN	4	43415545	missense	probably damaging	1.00
IGL02930:Rusc2	APN	4	43416376	missense	probably damaging	0.99
IGL03154:Rusc2	APN	4	43425806	missense	probably benign	0.00
P0026:Rusc2	UTSW	4	43415840	missense	possibly damaging	0.93
R0036:Rusc2	UTSW	4	43424009	missense	probably damaging	1.00
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0114:Rusc2	UTSW	4	43422055	missense	probably damaging	1.00
R0255:Rusc2	UTSW	4	43423954	missense	probably damaging	1.00
R0471:Rusc2	UTSW	4	43425486	missense	probably damaging	0.99
R1381:Rusc2	UTSW	4	43416137	missense	probably damaging	1.00
R1413:Rusc2	UTSW	4	43416568	missense	probably benign	0.00
R1416:Rusc2	UTSW	4	43421617	missense	possibly damaging	0.86
R1731:Rusc2	UTSW	4	43426046	missense	probably benign
R1864:Rusc2	UTSW	4	43421719	missense	possibly damaging	0.49
R1897:Rusc2	UTSW	4	43421749	missense	probably damaging	1.00
R2010:Rusc2	UTSW	4	43415212	missense	probably benign	0.06
R2212:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R2885:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R2886:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R3412:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3413:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3414:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3852:Rusc2	UTSW	4	43416424	missense	probably benign	0.45
R4135:Rusc2	UTSW	4	43425563	missense	possibly damaging	0.49
R4272:Rusc2	UTSW	4	43415533	missense	probably damaging	1.00
R4574:Rusc2	UTSW	4	43416080	missense	probably damaging	0.99
R4888:Rusc2	UTSW	4	43423942	missense	probably damaging	1.00
R5010:Rusc2	UTSW	4	43415926	missense	probably damaging	1.00
R5071:Rusc2	UTSW	4	43415240	missense	probably benign	0.05
R5131:Rusc2	UTSW	4	43414948	missense	probably benign	0.03
R5177:Rusc2	UTSW	4	43421805	splice site	probably null
R5540:Rusc2	UTSW	4	43423975	missense	probably damaging	1.00
R5561:Rusc2	UTSW	4	43415932	nonsense	probably null
R5628:Rusc2	UTSW	4	43425348	missense	probably damaging	1.00
R5645:Rusc2	UTSW	4	43425758	missense	probably benign	0.06
R6129:Rusc2	UTSW	4	43424271	missense	probably damaging	1.00
R6362:Rusc2	UTSW	4	43416416	missense	probably benign	0.30
R6633:Rusc2	UTSW	4	43414852	missense	probably damaging	0.99
R6980:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R7491:Rusc2	UTSW	4	43426528	missense	probably damaging	1.00
R7641:Rusc2	UTSW	4	43425335	missense	possibly damaging	0.84
R7698:Rusc2	UTSW	4	43414900	nonsense	probably null
R7710:Rusc2	UTSW	4	43416119	missense	probably benign	0.07
R8052:Rusc2	UTSW	4	43421851	missense	probably benign
R8061:Rusc2	UTSW	4	43422492	missense	probably damaging	1.00
R8127:Rusc2	UTSW	4	43423747	missense	possibly damaging	0.54
R8319:Rusc2	UTSW	4	43425378	missense	probably damaging	1.00
R8355:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8397:Rusc2	UTSW	4	43424206	missense	possibly damaging	0.95
R8455:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8553:Rusc2	UTSW	4	43416508	missense	probably benign	0.05
R8725:Rusc2	UTSW	4	43401351	intron	probably benign
R8725:Rusc2	UTSW	4	43415396	missense	probably damaging	0.99
R8727:Rusc2	UTSW	4	43401351	intron	probably benign
R8834:Rusc2	UTSW	4	43416431	missense	possibly damaging	0.94
R9295:Rusc2	UTSW	4	43416382	missense	probably damaging	0.98
X0025:Rusc2	UTSW	4	43422226	missense	probably benign	0.00
X0066:Rusc2	UTSW	4	43422204	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTATTACCTCTTCCAGAAGCCAG -3'
(R):5'- TGGATGGGCGAGAACTCTTG -3'

Sequencing Primer
(F):5'- TTACCTCTTCCAGAAGCCAGACATC -3'
(R):5'- TCTTGGGAAGAATCTCCAACG -3'

Posted On

2014-10-16