Incidental Mutation 'R2275:Col9a2'
ID 242713
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission 040274-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2275 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 120911455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 599 (R599G)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.3183 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,728,667 (GRCm39) C59S possibly damaging Het
Abca5 A T 11: 110,166,107 (GRCm39) N1556K possibly damaging Het
Ackr1 T C 1: 173,160,052 (GRCm39) N156D probably benign Het
Aco2 C T 15: 81,779,465 (GRCm39) R57C probably benign Het
Adamtsl3 A T 7: 82,255,766 (GRCm39) S1593C probably benign Het
Adgrb2 G A 4: 129,900,647 (GRCm39) G333D probably damaging Het
Arhgef7 T A 8: 11,865,010 (GRCm39) F374Y possibly damaging Het
Atxn7 T A 14: 14,013,268 (GRCm38) M62K possibly damaging Het
C87436 G A 6: 86,422,582 (GRCm39) R52H probably damaging Het
Cacna1g T A 11: 94,306,762 (GRCm39) E1842V probably damaging Het
Cdh4 T C 2: 179,532,640 (GRCm39) S701P probably damaging Het
Cdr2 A T 7: 120,557,732 (GRCm39) H264Q possibly damaging Het
Cecr2 C T 6: 120,733,702 (GRCm39) S563L probably benign Het
Cfap276 A G 3: 108,449,819 (GRCm39) N33D possibly damaging Het
Col12a1 A T 9: 79,542,709 (GRCm39) V2352E probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Csad G T 15: 102,095,557 (GRCm39) R167S probably damaging Het
Dnlz A T 2: 26,241,483 (GRCm39) C82S probably damaging Het
Ehmt2 T A 17: 35,129,691 (GRCm39) N951K possibly damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Enpp2 A C 15: 54,761,190 (GRCm39) Y221D probably damaging Het
Exoc3l A T 8: 106,017,079 (GRCm39) probably null Het
F11 T C 8: 45,705,184 (GRCm39) D119G possibly damaging Het
Faiml T C 9: 99,111,612 (GRCm39) Y149C probably benign Het
Fn1 C T 1: 71,653,102 (GRCm39) G1296R probably null Het
Glg1 A T 8: 111,895,353 (GRCm39) Y819* probably null Het
Gm11568 A G 11: 99,749,070 (GRCm39) S92G unknown Het
Gm28042 A C 2: 119,867,310 (GRCm39) Q465P probably damaging Het
Gpatch1 A T 7: 34,988,103 (GRCm39) S678T probably benign Het
Gpr158 A T 2: 21,831,674 (GRCm39) M925L probably benign Het
Hecw1 T C 13: 14,520,653 (GRCm39) T195A probably benign Het
Hoxd1 A G 2: 74,594,501 (GRCm39) K252R probably damaging Het
Iqck G A 7: 118,498,880 (GRCm39) D173N possibly damaging Het
Kcnh1 T G 1: 192,019,829 (GRCm39) V358G probably damaging Het
Kifap3 T A 1: 163,696,327 (GRCm39) V652D possibly damaging Het
Knl1 C A 2: 118,902,762 (GRCm39) Q1488K probably damaging Het
Map4k1 T A 7: 28,701,382 (GRCm39) H729Q probably damaging Het
Marchf1 T A 8: 66,840,151 (GRCm39) N311K probably benign Het
Mypn A G 10: 62,966,848 (GRCm39) F943L probably damaging Het
Nkpd1 A G 7: 19,257,822 (GRCm39) I534V probably benign Het
Nrarp T C 2: 25,071,421 (GRCm39) V100A possibly damaging Het
Nt5c1a T C 4: 123,109,873 (GRCm39) F324S probably damaging Het
Ntrk2 T A 13: 59,009,165 (GRCm39) Y319N probably damaging Het
Odad2 C A 18: 7,223,676 (GRCm39) G456W probably benign Het
Or5d41 A G 2: 88,055,167 (GRCm39) F70L probably benign Het
Parg A G 14: 32,017,195 (GRCm39) D384G probably damaging Het
Pde7b T A 10: 20,276,165 (GRCm39) *460L probably null Het
Pigr G T 1: 130,774,207 (GRCm39) V396L probably benign Het
Pkhd1 A G 1: 20,271,073 (GRCm39) I3160T possibly damaging Het
Ppl T C 16: 4,912,416 (GRCm39) S722G probably benign Het
Ppp1r26 A G 2: 28,342,713 (GRCm39) E781G possibly damaging Het
Rptor T A 11: 119,647,148 (GRCm39) C246* probably null Het
Rusc2 G A 4: 43,416,260 (GRCm39) R522H probably damaging Het
Senp7 T C 16: 56,005,146 (GRCm39) S927P probably damaging Het
Serpinb6d A T 13: 33,855,411 (GRCm39) M362L probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc12a3 T A 8: 95,059,915 (GRCm39) I187N possibly damaging Het
Slc46a1 T G 11: 78,357,249 (GRCm39) S101A probably benign Het
Slc4a8 A G 15: 100,705,283 (GRCm39) M830V probably benign Het
Slco4a1 T C 2: 180,106,529 (GRCm39) L237P possibly damaging Het
Sned1 T A 1: 93,209,364 (GRCm39) probably null Het
Tia1 A G 6: 86,404,659 (GRCm39) N298S probably benign Het
Tsr1 A T 11: 74,795,653 (GRCm39) probably null Het
Ttc6 G A 12: 57,749,084 (GRCm39) V1339I probably benign Het
Tyrp1 A T 4: 80,755,771 (GRCm39) E180V probably damaging Het
Ubr3 T C 2: 69,846,685 (GRCm39) V1636A probably benign Het
Usp1 T C 4: 98,818,079 (GRCm39) L139P probably damaging Het
Vmn1r228 A G 17: 20,996,807 (GRCm39) L237P probably damaging Het
Vmn1r232 A G 17: 21,134,465 (GRCm39) L45P probably benign Het
Vmn2r2 T C 3: 64,023,930 (GRCm39) R884G probably benign Het
Vmn2r60 T A 7: 41,786,251 (GRCm39) Y351* probably null Het
Zbtb7a G A 10: 80,980,831 (GRCm39) V342I possibly damaging Het
Zdhhc11 C A 13: 74,121,871 (GRCm39) N127K probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACCTCCCAAATCTTATCTGG -3'
(R):5'- TCAAGAGTCCCAACTGCCAG -3'

Sequencing Primer
(F):5'- AACCTCCCAAATCTTATCTGGATCTC -3'
(R):5'- AGAGACACCTCCAGCTTGG -3'
Posted On 2014-10-16