Incidental Mutation 'R2275:Tia1'
ID242717
Institutional Source Beutler Lab
Gene Symbol Tia1
Ensembl Gene ENSMUSG00000071337
Gene Namecytotoxic granule-associated RNA binding protein 1
Synonyms2310050N03Rik, mTIA-1
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R2275 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86404219-86433405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86427677 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 298 (N298S)
Ref Sequence ENSEMBL: ENSMUSP00000093426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095752] [ENSMUST00000095753] [ENSMUST00000095754] [ENSMUST00000113712] [ENSMUST00000113713] [ENSMUST00000123267] [ENSMUST00000130967] [ENSMUST00000148728] [ENSMUST00000154438] [ENSMUST00000204137]
Predicted Effect probably benign
Transcript: ENSMUST00000095752
AA Change: N287S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093424
Gene: ENSMUSG00000071337
AA Change: N287S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 271 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095753
AA Change: N298S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093425
Gene: ENSMUSG00000071337
AA Change: N298S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095754
AA Change: N298S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000093426
Gene: ENSMUSG00000071337
AA Change: N298S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113708
SMART Domains Protein: ENSMUSP00000109338
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113712
SMART Domains Protein: ENSMUSP00000138652
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113713
AA Change: N289S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109342
Gene: ENSMUSG00000071337
AA Change: N289S

DomainStartEndE-ValueType
RRM 8 81 1.62e-23 SMART
RRM 98 171 5.15e-26 SMART
RRM 206 273 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123002
Predicted Effect probably benign
Transcript: ENSMUST00000123267
SMART Domains Protein: ENSMUSP00000145407
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 12 79 1e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126404
Predicted Effect probably benign
Transcript: ENSMUST00000130967
SMART Domains Protein: ENSMUSP00000118558
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 258 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147104
Predicted Effect probably benign
Transcript: ENSMUST00000148728
SMART Domains Protein: ENSMUSP00000144857
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Pfam:RRM_1 97 131 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152852
Predicted Effect probably benign
Transcript: ENSMUST00000154438
SMART Domains Protein: ENSMUSP00000145218
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203763
Predicted Effect probably benign
Transcript: ENSMUST00000204137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205109
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced postnatal survival and functional abnormalities in the immune system with no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Tia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02643:Tia1 APN 6 86416390 missense probably benign 0.16
R0322:Tia1 UTSW 6 86420387 missense probably damaging 1.00
R1118:Tia1 UTSW 6 86419109 missense probably benign 0.00
R1451:Tia1 UTSW 6 86430339 missense probably benign 0.00
R1631:Tia1 UTSW 6 86420348 missense probably damaging 1.00
R2509:Tia1 UTSW 6 86424330 splice site probably null
R3952:Tia1 UTSW 6 86416337 missense probably damaging 1.00
R4596:Tia1 UTSW 6 86420407 missense probably benign 0.34
R4674:Tia1 UTSW 6 86420400 missense probably damaging 0.99
R4919:Tia1 UTSW 6 86424323 unclassified probably benign
R6339:Tia1 UTSW 6 86426656 missense probably damaging 1.00
R6455:Tia1 UTSW 6 86420378 missense probably damaging 1.00
R7139:Tia1 UTSW 6 86427688 missense possibly damaging 0.95
R7804:Tia1 UTSW 6 86424382 missense probably benign 0.02
R7879:Tia1 UTSW 6 86424365 missense probably damaging 0.97
R7962:Tia1 UTSW 6 86424365 missense probably damaging 0.97
R8018:Tia1 UTSW 6 86425052 missense not run
Predicted Primers PCR Primer
(F):5'- GAGCCTTTCAAAGACTGCACC -3'
(R):5'- TGTTTTCCACGGTTAAGAAAGGC -3'

Sequencing Primer
(F):5'- GCACCACATAGTTACAGTAGCATATG -3'
(R):5'- TTTCCACGGTTAAGAAAGGCAAAGC -3'
Posted On2014-10-16