Mutagenetix > Incidental Mutations

Incidental Mutation 'R2275:Cecr2'

242719

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

040274-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2275 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 120756741 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 563 (S563L)

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]

Predicted Effect

probably benign
Transcript: ENSMUST00000100993
AA Change: S563L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: S563L

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112686
AA Change: S563L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: S563L

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124634

Predicted Effect

probably benign
Transcript: ENSMUST00000129803

SMART Domains

Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
coiled coil region	90	150	N/A	INTRINSIC
Pfam:Bromodomain	191	234	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143563

SMART Domains

Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	63	79	N/A	INTRINSIC
low complexity region	114	131	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	A	G	3: 108,542,503	N33D	possibly damaging	Het
2300003K06Rik	A	T	11: 99,837,841	C59S	possibly damaging	Het
Abca5	A	T	11: 110,275,281	N1556K	possibly damaging	Het
Ackr1	T	C	1: 173,332,485	N156D	probably benign	Het
Aco2	C	T	15: 81,895,264	R57C	probably benign	Het
Adamtsl3	A	T	7: 82,606,558	S1593C	probably benign	Het
Adgrb2	G	A	4: 130,006,854	G333D	probably damaging	Het
Arhgef7	T	A	8: 11,815,010	F374Y	possibly damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Atxn7	T	A	14: 14,013,268	M62K	possibly damaging	Het
C87436	G	A	6: 86,445,600	R52H	probably damaging	Het
Cacna1g	T	A	11: 94,415,936	E1842V	probably damaging	Het
Cdh4	T	C	2: 179,890,847	S701P	probably damaging	Het
Cdr2	A	T	7: 120,958,509	H264Q	possibly damaging	Het
Col12a1	A	T	9: 79,635,427	V2352E	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csad	G	T	15: 102,187,122	R167S	probably damaging	Het
Dnlz	A	T	2: 26,351,471	C82S	probably damaging	Het
Ehmt2	T	A	17: 34,910,715	N951K	possibly damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Enpp2	A	C	15: 54,897,794	Y221D	probably damaging	Het
Exoc3l	A	T	8: 105,290,447		probably null	Het
F11	T	C	8: 45,252,147	D119G	possibly damaging	Het
Faiml	T	C	9: 99,229,559	Y149C	probably benign	Het
Fn1	C	T	1: 71,613,943	G1296R	probably null	Het
Glg1	A	T	8: 111,168,721	Y819*	probably null	Het
Gm11568	A	G	11: 99,858,244	S92G	unknown	Het
Gm28042	A	C	2: 120,036,829	Q465P	probably damaging	Het
Gpatch1	A	T	7: 35,288,678	S678T	probably benign	Het
Gpr158	A	T	2: 21,826,863	M925L	probably benign	Het
Hecw1	T	C	13: 14,346,068	T195A	probably benign	Het
Hoxd1	A	G	2: 74,764,157	K252R	probably damaging	Het
Iqck	G	A	7: 118,899,657	D173N	possibly damaging	Het
Kcnh1	T	G	1: 192,337,521	V358G	probably damaging	Het
Kifap3	T	A	1: 163,868,758	V652D	possibly damaging	Het
Knl1	C	A	2: 119,072,281	Q1488K	probably damaging	Het
Map4k1	T	A	7: 29,001,957	H729Q	probably damaging	Het
March1	T	A	8: 66,387,499	N311K	probably benign	Het
Mypn	A	G	10: 63,131,069	F943L	probably damaging	Het
Nkpd1	A	G	7: 19,523,897	I534V	probably benign	Het
Nrarp	T	C	2: 25,181,409	V100A	possibly damaging	Het
Nt5c1a	T	C	4: 123,216,080	F324S	probably damaging	Het
Ntrk2	T	A	13: 58,861,351	Y319N	probably damaging	Het
Olfr1170	A	G	2: 88,224,823	F70L	probably benign	Het
Parg	A	G	14: 32,295,238	D384G	probably damaging	Het
Pde7b	T	A	10: 20,400,419	*460L	probably null	Het
Pigr	G	T	1: 130,846,470	V396L	probably benign	Het
Pkhd1	A	G	1: 20,200,849	I3160T	possibly damaging	Het
Ppl	T	C	16: 5,094,552	S722G	probably benign	Het
Ppp1r26	A	G	2: 28,452,701	E781G	possibly damaging	Het
Rptor	T	A	11: 119,756,322	C246*	probably null	Het
Rusc2	G	A	4: 43,416,260	R522H	probably damaging	Het
Senp7	T	C	16: 56,184,783	S927P	probably damaging	Het
Serpinb6d	A	T	13: 33,671,428	M362L	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slc12a3	T	A	8: 94,333,287	I187N	possibly damaging	Het
Slc46a1	T	G	11: 78,466,423	S101A	probably benign	Het
Slc4a8	A	G	15: 100,807,402	M830V	probably benign	Het
Slco4a1	T	C	2: 180,464,736	L237P	possibly damaging	Het
Sned1	T	A	1: 93,281,642		probably null	Het
Tia1	A	G	6: 86,427,677	N298S	probably benign	Het
Tsr1	A	T	11: 74,904,827		probably null	Het
Ttc6	G	A	12: 57,702,298	V1339I	probably benign	Het
Tyrp1	A	T	4: 80,837,534	E180V	probably damaging	Het
Ubr3	T	C	2: 70,016,341	V1636A	probably benign	Het
Usp1	T	C	4: 98,929,842	L139P	probably damaging	Het
Vmn1r228	A	G	17: 20,776,545	L237P	probably damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Vmn2r2	T	C	3: 64,116,509	R884G	probably benign	Het
Vmn2r60	T	A	7: 42,136,827	Y351*	probably null	Het
Zbtb7a	G	A	10: 81,144,997	V342I	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,752	N127K	probably damaging	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	intron	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTATAGTAAAATATGTACCCTGGTGG -3'
(R):5'- CTAGGCACCCTACCACAGTG -3'

Sequencing Primer
(F):5'- CCAAGATGTCTGACAATTTAGAGCG -3'
(R):5'- ACCCTACCACAGTGCAGGG -3'

Posted On

2014-10-16