Incidental Mutation 'R2275:Cecr2'
ID242719
Institutional Source Beutler Lab
Gene Symbol Cecr2
Ensembl Gene ENSMUSG00000071226
Gene NameCECR2, histone acetyl-lysine reader
SynonymsGtl4, 2610101O16Rik, 2810409N01Rik
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2275 (G1)
Quality Score218
Status Not validated
Chromosome6
Chromosomal Location120666369-120771190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120756741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 563 (S563L)
Ref Sequence ENSEMBL: ENSMUSP00000108306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]
Predicted Effect probably benign
Transcript: ENSMUST00000100993
AA Change: S563L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: S563L

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:WHIM3 244 284 5.2e-11 PFAM
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 781 796 N/A INTRINSIC
low complexity region 839 855 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
low complexity region 1202 1223 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112686
AA Change: S563L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: S563L

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 862 879 N/A INTRINSIC
low complexity region 1145 1159 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124634
Predicted Effect probably benign
Transcript: ENSMUST00000129803
SMART Domains Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
coiled coil region 90 150 N/A INTRINSIC
Pfam:Bromodomain 191 234 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143563
SMART Domains Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
low complexity region 114 131 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Cecr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cecr2 APN 6 120756717 missense probably damaging 1.00
IGL00782:Cecr2 APN 6 120761621 missense probably benign 0.00
IGL01137:Cecr2 APN 6 120762028 missense probably damaging 1.00
IGL01446:Cecr2 APN 6 120758599 missense probably benign
IGL02108:Cecr2 APN 6 120762558 critical splice donor site probably null
IGL02195:Cecr2 APN 6 120731406 missense probably damaging 1.00
IGL02689:Cecr2 APN 6 120762167 missense probably damaging 1.00
IGL03189:Cecr2 APN 6 120762430 missense probably benign 0.13
PIT1430001:Cecr2 UTSW 6 120758479 missense probably benign 0.01
R0200:Cecr2 UTSW 6 120761797 missense probably damaging 1.00
R0586:Cecr2 UTSW 6 120757884 missense probably damaging 1.00
R0715:Cecr2 UTSW 6 120758198 missense probably benign 0.21
R0784:Cecr2 UTSW 6 120758149 missense possibly damaging 0.74
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1343:Cecr2 UTSW 6 120754711 missense probably damaging 0.99
R1349:Cecr2 UTSW 6 120757603 missense probably damaging 0.99
R1386:Cecr2 UTSW 6 120762131 missense probably damaging 1.00
R1438:Cecr2 UTSW 6 120761472 nonsense probably null
R1602:Cecr2 UTSW 6 120755587 missense possibly damaging 0.52
R1664:Cecr2 UTSW 6 120762026 missense probably damaging 0.96
R1731:Cecr2 UTSW 6 120758180 missense possibly damaging 0.74
R1817:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1818:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1819:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1862:Cecr2 UTSW 6 120757941 missense probably damaging 1.00
R1907:Cecr2 UTSW 6 120761160 missense probably benign 0.03
R1911:Cecr2 UTSW 6 120762565 unclassified probably benign
R2135:Cecr2 UTSW 6 120720962 missense probably damaging 1.00
R2273:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R3713:Cecr2 UTSW 6 120758260 missense probably damaging 1.00
R4271:Cecr2 UTSW 6 120762475 missense probably damaging 1.00
R4706:Cecr2 UTSW 6 120755578 missense possibly damaging 0.73
R4873:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R4875:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R5137:Cecr2 UTSW 6 120755517 missense probably benign
R5153:Cecr2 UTSW 6 120734560 missense probably benign 0.03
R5377:Cecr2 UTSW 6 120756569 missense possibly damaging 0.87
R5598:Cecr2 UTSW 6 120731446 splice site probably null
R5651:Cecr2 UTSW 6 120755560 missense probably damaging 0.96
R5680:Cecr2 UTSW 6 120761426 missense probably benign
R5813:Cecr2 UTSW 6 120762208 missense probably damaging 0.99
R5970:Cecr2 UTSW 6 120720907 missense probably damaging 0.98
R6255:Cecr2 UTSW 6 120758050 missense probably damaging 1.00
R6266:Cecr2 UTSW 6 120761686 missense probably benign
R6630:Cecr2 UTSW 6 120762178 missense probably damaging 1.00
R6737:Cecr2 UTSW 6 120737123 missense possibly damaging 0.86
R6754:Cecr2 UTSW 6 120757578 missense probably damaging 0.98
R6807:Cecr2 UTSW 6 120734542 intron probably null
R7187:Cecr2 UTSW 6 120756686 missense probably benign
R7256:Cecr2 UTSW 6 120762529 missense probably benign
R7282:Cecr2 UTSW 6 120761621 missense
R7548:Cecr2 UTSW 6 120761714 missense
R7596:Cecr2 UTSW 6 120762206 missense probably benign
R7802:Cecr2 UTSW 6 120743847 missense probably benign 0.45
X0012:Cecr2 UTSW 6 120733774 missense probably damaging 0.99
X0063:Cecr2 UTSW 6 120762071 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTATAGTAAAATATGTACCCTGGTGG -3'
(R):5'- CTAGGCACCCTACCACAGTG -3'

Sequencing Primer
(F):5'- CCAAGATGTCTGACAATTTAGAGCG -3'
(R):5'- ACCCTACCACAGTGCAGGG -3'
Posted On2014-10-16