Incidental Mutation 'R2275:Marchf1'
ID 242731
Institutional Source Beutler Lab
Gene Symbol Marchf1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane associated ring-CH-type finger 1
Synonyms March1, 2900024D24Rik
MMRRC Submission 040274-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R2275 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 66070552-66924289 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66840151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 311 (N311K)
Ref Sequence ENSEMBL: ENSMUSP00000105885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110259] [ENSMUST00000178982] [ENSMUST00000110258]
AlphaFold Q6NZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000039540
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072482
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098708
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110255
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110256
AA Change: N311K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: N311K

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132019
Predicted Effect probably benign
Transcript: ENSMUST00000110259
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178982
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110258
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,728,667 (GRCm39) C59S possibly damaging Het
Abca5 A T 11: 110,166,107 (GRCm39) N1556K possibly damaging Het
Ackr1 T C 1: 173,160,052 (GRCm39) N156D probably benign Het
Aco2 C T 15: 81,779,465 (GRCm39) R57C probably benign Het
Adamtsl3 A T 7: 82,255,766 (GRCm39) S1593C probably benign Het
Adgrb2 G A 4: 129,900,647 (GRCm39) G333D probably damaging Het
Arhgef7 T A 8: 11,865,010 (GRCm39) F374Y possibly damaging Het
Atxn7 T A 14: 14,013,268 (GRCm38) M62K possibly damaging Het
C87436 G A 6: 86,422,582 (GRCm39) R52H probably damaging Het
Cacna1g T A 11: 94,306,762 (GRCm39) E1842V probably damaging Het
Cdh4 T C 2: 179,532,640 (GRCm39) S701P probably damaging Het
Cdr2 A T 7: 120,557,732 (GRCm39) H264Q possibly damaging Het
Cecr2 C T 6: 120,733,702 (GRCm39) S563L probably benign Het
Cfap276 A G 3: 108,449,819 (GRCm39) N33D possibly damaging Het
Col12a1 A T 9: 79,542,709 (GRCm39) V2352E probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Csad G T 15: 102,095,557 (GRCm39) R167S probably damaging Het
Dnlz A T 2: 26,241,483 (GRCm39) C82S probably damaging Het
Ehmt2 T A 17: 35,129,691 (GRCm39) N951K possibly damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Enpp2 A C 15: 54,761,190 (GRCm39) Y221D probably damaging Het
Exoc3l A T 8: 106,017,079 (GRCm39) probably null Het
F11 T C 8: 45,705,184 (GRCm39) D119G possibly damaging Het
Faiml T C 9: 99,111,612 (GRCm39) Y149C probably benign Het
Fn1 C T 1: 71,653,102 (GRCm39) G1296R probably null Het
Glg1 A T 8: 111,895,353 (GRCm39) Y819* probably null Het
Gm11568 A G 11: 99,749,070 (GRCm39) S92G unknown Het
Gm28042 A C 2: 119,867,310 (GRCm39) Q465P probably damaging Het
Gpatch1 A T 7: 34,988,103 (GRCm39) S678T probably benign Het
Gpr158 A T 2: 21,831,674 (GRCm39) M925L probably benign Het
Hecw1 T C 13: 14,520,653 (GRCm39) T195A probably benign Het
Hoxd1 A G 2: 74,594,501 (GRCm39) K252R probably damaging Het
Iqck G A 7: 118,498,880 (GRCm39) D173N possibly damaging Het
Kcnh1 T G 1: 192,019,829 (GRCm39) V358G probably damaging Het
Kifap3 T A 1: 163,696,327 (GRCm39) V652D possibly damaging Het
Knl1 C A 2: 118,902,762 (GRCm39) Q1488K probably damaging Het
Map4k1 T A 7: 28,701,382 (GRCm39) H729Q probably damaging Het
Mypn A G 10: 62,966,848 (GRCm39) F943L probably damaging Het
Nkpd1 A G 7: 19,257,822 (GRCm39) I534V probably benign Het
Nrarp T C 2: 25,071,421 (GRCm39) V100A possibly damaging Het
Nt5c1a T C 4: 123,109,873 (GRCm39) F324S probably damaging Het
Ntrk2 T A 13: 59,009,165 (GRCm39) Y319N probably damaging Het
Odad2 C A 18: 7,223,676 (GRCm39) G456W probably benign Het
Or5d41 A G 2: 88,055,167 (GRCm39) F70L probably benign Het
Parg A G 14: 32,017,195 (GRCm39) D384G probably damaging Het
Pde7b T A 10: 20,276,165 (GRCm39) *460L probably null Het
Pigr G T 1: 130,774,207 (GRCm39) V396L probably benign Het
Pkhd1 A G 1: 20,271,073 (GRCm39) I3160T possibly damaging Het
Ppl T C 16: 4,912,416 (GRCm39) S722G probably benign Het
Ppp1r26 A G 2: 28,342,713 (GRCm39) E781G possibly damaging Het
Rptor T A 11: 119,647,148 (GRCm39) C246* probably null Het
Rusc2 G A 4: 43,416,260 (GRCm39) R522H probably damaging Het
Senp7 T C 16: 56,005,146 (GRCm39) S927P probably damaging Het
Serpinb6d A T 13: 33,855,411 (GRCm39) M362L probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc12a3 T A 8: 95,059,915 (GRCm39) I187N possibly damaging Het
Slc46a1 T G 11: 78,357,249 (GRCm39) S101A probably benign Het
Slc4a8 A G 15: 100,705,283 (GRCm39) M830V probably benign Het
Slco4a1 T C 2: 180,106,529 (GRCm39) L237P possibly damaging Het
Sned1 T A 1: 93,209,364 (GRCm39) probably null Het
Tia1 A G 6: 86,404,659 (GRCm39) N298S probably benign Het
Tsr1 A T 11: 74,795,653 (GRCm39) probably null Het
Ttc6 G A 12: 57,749,084 (GRCm39) V1339I probably benign Het
Tyrp1 A T 4: 80,755,771 (GRCm39) E180V probably damaging Het
Ubr3 T C 2: 69,846,685 (GRCm39) V1636A probably benign Het
Usp1 T C 4: 98,818,079 (GRCm39) L139P probably damaging Het
Vmn1r228 A G 17: 20,996,807 (GRCm39) L237P probably damaging Het
Vmn1r232 A G 17: 21,134,465 (GRCm39) L45P probably benign Het
Vmn2r2 T C 3: 64,023,930 (GRCm39) R884G probably benign Het
Vmn2r60 T A 7: 41,786,251 (GRCm39) Y351* probably null Het
Zbtb7a G A 10: 80,980,831 (GRCm39) V342I possibly damaging Het
Zdhhc11 C A 13: 74,121,871 (GRCm39) N127K probably damaging Het
Other mutations in Marchf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Marchf1 APN 8 66,871,529 (GRCm39) missense possibly damaging 0.88
IGL02468:Marchf1 APN 8 66,871,563 (GRCm39) missense probably damaging 1.00
R0391:Marchf1 UTSW 8 66,871,625 (GRCm39) missense probably damaging 1.00
R1500:Marchf1 UTSW 8 66,921,042 (GRCm39) missense probably damaging 1.00
R1794:Marchf1 UTSW 8 66,839,594 (GRCm39) missense possibly damaging 0.63
R2015:Marchf1 UTSW 8 66,574,473 (GRCm39) missense probably damaging 0.99
R2184:Marchf1 UTSW 8 66,840,075 (GRCm39) missense probably benign 0.07
R2273:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2274:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2314:Marchf1 UTSW 8 66,574,442 (GRCm39) start codon destroyed probably null 0.77
R3114:Marchf1 UTSW 8 66,840,033 (GRCm39) missense probably benign
R4458:Marchf1 UTSW 8 66,908,823 (GRCm39) missense probably damaging 1.00
R4656:Marchf1 UTSW 8 66,839,071 (GRCm39) missense probably benign 0.05
R4773:Marchf1 UTSW 8 66,839,876 (GRCm39) missense probably benign 0.03
R4838:Marchf1 UTSW 8 66,921,015 (GRCm39) missense probably damaging 1.00
R5073:Marchf1 UTSW 8 66,839,020 (GRCm39) missense probably benign 0.03
R5507:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R5575:Marchf1 UTSW 8 66,920,962 (GRCm39) missense probably damaging 1.00
R5916:Marchf1 UTSW 8 66,839,763 (GRCm39) missense possibly damaging 0.89
R6931:Marchf1 UTSW 8 66,921,144 (GRCm39) missense probably benign 0.03
R7350:Marchf1 UTSW 8 66,921,051 (GRCm39) nonsense probably null
R7487:Marchf1 UTSW 8 66,908,726 (GRCm39) missense probably benign 0.14
R7531:Marchf1 UTSW 8 66,838,989 (GRCm39) missense probably benign
R7563:Marchf1 UTSW 8 66,920,965 (GRCm39) missense probably damaging 1.00
R7705:Marchf1 UTSW 8 66,921,169 (GRCm39) missense probably benign 0.00
R8142:Marchf1 UTSW 8 66,908,778 (GRCm39) missense probably benign 0.07
R8337:Marchf1 UTSW 8 66,871,641 (GRCm39) missense probably damaging 1.00
R8712:Marchf1 UTSW 8 66,921,000 (GRCm39) missense probably damaging 1.00
R9188:Marchf1 UTSW 8 66,908,803 (GRCm39) nonsense probably null
R9372:Marchf1 UTSW 8 66,921,145 (GRCm39) missense probably benign 0.01
R9477:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R9790:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
R9791:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGAATGCAGTCATCCACCGC -3'
(R):5'- TGCCCATTTCTATTCCAGGATAAG -3'

Sequencing Primer
(F):5'- TCCTTGGTGGAGAGGACAC -3'
(R):5'- AAAACCCAATCCCATGTTTTTGTACC -3'
Posted On 2014-10-16