Incidental Mutation 'R2275:Slc12a3'
ID242732
Institutional Source Beutler Lab
Gene Symbol Slc12a3
Ensembl Gene ENSMUSG00000031766
Gene Namesolute carrier family 12, member 3
SynonymsNCC, TSC
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2275 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94329201-94366214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94333287 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 187 (I187N)
Ref Sequence ENSEMBL: ENSMUSP00000148455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034218] [ENSMUST00000212134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034218
AA Change: I187N

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: I187N

DomainStartEndE-ValueType
Pfam:AA_permease_N 43 114 1.5e-30 PFAM
Pfam:AA_permease 139 645 3.6e-145 PFAM
Pfam:SLC12 653 801 1.4e-53 PFAM
Pfam:SLC12 787 1001 2e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212041
Predicted Effect possibly damaging
Transcript: ENSMUST00000212134
AA Change: I187N

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Slc12a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Slc12a3 APN 8 94357096 missense probably benign 0.00
IGL01947:Slc12a3 APN 8 94365819 critical splice acceptor site probably null
IGL02151:Slc12a3 APN 8 94348592 missense probably benign 0.26
IGL02440:Slc12a3 APN 8 94331682 missense probably damaging 1.00
IGL03213:Slc12a3 APN 8 94335305 missense possibly damaging 0.95
IGL03260:Slc12a3 APN 8 94333242 missense probably damaging 1.00
IGL03306:Slc12a3 APN 8 94351758 missense possibly damaging 0.72
IGL03329:Slc12a3 APN 8 94365891 missense possibly damaging 0.67
avaricious UTSW 8 94330472 missense probably benign 0.01
Pugilist UTSW 8 94345773 critical splice acceptor site probably null
R0131:Slc12a3 UTSW 8 94340883 splice site probably benign
R0189:Slc12a3 UTSW 8 94356358 missense probably benign 0.30
R0330:Slc12a3 UTSW 8 94346346 missense possibly damaging 0.75
R0569:Slc12a3 UTSW 8 94330525 critical splice donor site probably null
R0715:Slc12a3 UTSW 8 94329433 missense possibly damaging 0.75
R1248:Slc12a3 UTSW 8 94333277 missense probably damaging 1.00
R1565:Slc12a3 UTSW 8 94345877 missense possibly damaging 0.75
R2068:Slc12a3 UTSW 8 94345828 missense probably damaging 1.00
R2108:Slc12a3 UTSW 8 94340530 missense probably damaging 0.97
R2273:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2274:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2433:Slc12a3 UTSW 8 94346316 missense probably benign 0.00
R3770:Slc12a3 UTSW 8 94353040 missense probably benign
R4429:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4431:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4533:Slc12a3 UTSW 8 94357086 missense probably null 0.02
R4627:Slc12a3 UTSW 8 94329384 missense probably benign
R4856:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4886:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4908:Slc12a3 UTSW 8 94348588 missense possibly damaging 0.76
R5054:Slc12a3 UTSW 8 94346351 missense probably damaging 1.00
R5299:Slc12a3 UTSW 8 94351789 missense probably damaging 1.00
R5451:Slc12a3 UTSW 8 94357027 missense possibly damaging 0.61
R5590:Slc12a3 UTSW 8 94345788 missense probably damaging 1.00
R5725:Slc12a3 UTSW 8 94330446 missense probably benign 0.00
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6162:Slc12a3 UTSW 8 94345773 critical splice acceptor site probably null
R6266:Slc12a3 UTSW 8 94358471 missense possibly damaging 0.93
R6489:Slc12a3 UTSW 8 94335004 missense possibly damaging 0.96
R6521:Slc12a3 UTSW 8 94343113 missense possibly damaging 0.84
R6882:Slc12a3 UTSW 8 94365918 missense possibly damaging 0.51
R7051:Slc12a3 UTSW 8 94365944 missense probably damaging 1.00
R7510:Slc12a3 UTSW 8 94365849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGCAAACTAAGGCTCAG -3'
(R):5'- CCCAGACTCCGGGAAATAAG -3'

Sequencing Primer
(F):5'- CTCAGAGAAAGGGACTCGGGTC -3'
(R):5'- CCAAGGGCCACAAGGTG -3'
Posted On2014-10-16