Incidental Mutation 'R2275:Glg1'
ID242734
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Namegolgi apparatus protein 1
SynonymsSelel, CFR, MG-160, CFR-1, ESL-1, MG160
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R2275 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111154421-111259216 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 111168721 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 819 (Y819*)
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
Predicted Effect probably null
Transcript: ENSMUST00000003404
AA Change: Y808*
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: Y808*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168741
AA Change: Y212*
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316
AA Change: Y212*

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169020
AA Change: Y819*
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: Y819*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
diabolical UTSW 8 111168743 missense probably damaging 1.00
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1899:Glg1 UTSW 8 111165674 missense probably benign 0.23
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111165691 missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6476:Glg1 UTSW 8 111200174 missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111178865 missense probably benign 0.19
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGCAAAGCACTCTGG -3'
(R):5'- TCCGAGCCATTAGTCAACAG -3'

Sequencing Primer
(F):5'- GGACAGCCCAAGTGCACAATG -3'
(R):5'- CAATTTGACATCTCCATGGGGCTAG -3'
Posted On2014-10-16