Incidental Mutation 'R2275:Zbtb7a'
ID242739
Institutional Source Beutler Lab
Gene Symbol Zbtb7a
Ensembl Gene ENSMUSG00000035011
Gene Namezinc finger and BTB domain containing 7a
SynonymsLeukemia/lymphoma Related Factor, 9030619K07Rik, 9130006G12Rik, FBI-1, Pokemon, Lrf, Zbtb7
MMRRC Submission 040274-MU
Accession Numbers

Genbank: NM_010731; MGI: 1335091

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2275 (G1)
Quality Score178
Status Not validated
Chromosome10
Chromosomal Location81135220-81152995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81144997 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 342 (V342I)
Ref Sequence ENSEMBL: ENSMUSP00000113787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048128] [ENSMUST00000117956] [ENSMUST00000119606] [ENSMUST00000121840] [ENSMUST00000125261] [ENSMUST00000146895]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048128
AA Change: V342I

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047333
Gene: ENSMUSG00000035011
AA Change: V342I

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117956
AA Change: V342I

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113428
Gene: ENSMUSG00000035011
AA Change: V342I

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119606
AA Change: V342I

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113612
Gene: ENSMUSG00000035011
AA Change: V342I

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121840
AA Change: V342I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113787
Gene: ENSMUSG00000035011
AA Change: V342I

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125261
SMART Domains Protein: ENSMUSP00000114470
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146895
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die around E16.5 due to anemia and exhibit a cell autonomous defect in early B cell development. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(54)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Zbtb7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02937:Zbtb7a APN 10 81144298 missense probably benign 0.30
Bushel UTSW 10 81148329 missense probably benign 0.01
dram UTSW 10 81144266 missense probably damaging 1.00
Gallon UTSW 10 81144440 missense probably damaging 1.00
peck UTSW 10 81143986 missense probably damaging 1.00
D6062:Zbtb7a UTSW 10 81144358 missense probably damaging 0.99
R0529:Zbtb7a UTSW 10 81143986 missense probably damaging 1.00
R0562:Zbtb7a UTSW 10 81148329 missense probably benign 0.01
R2045:Zbtb7a UTSW 10 81144410 missense probably benign 0.03
R3755:Zbtb7a UTSW 10 81144266 missense probably damaging 1.00
R3883:Zbtb7a UTSW 10 81148025 missense probably damaging 1.00
R4723:Zbtb7a UTSW 10 81144440 missense probably damaging 1.00
R5503:Zbtb7a UTSW 10 81144797 missense probably damaging 0.96
R5650:Zbtb7a UTSW 10 81145049 missense probably damaging 1.00
R6872:Zbtb7a UTSW 10 81148071 missense possibly damaging 0.95
R7196:Zbtb7a UTSW 10 81144600 missense probably damaging 0.99
R7558:Zbtb7a UTSW 10 81148435 makesense probably null
R7602:Zbtb7a UTSW 10 81144176 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAGAACGGCCACTATGG -3'
(R):5'- TTACACTCGTAGGGCTTCTCG -3'

Sequencing Primer
(F):5'- ACTATGGCCGTGCAGGG -3'
(R):5'- CTTCTCGCCCGTGTGCG -3'
Posted On2014-10-16