Incidental Mutation 'R0172:Acp7'
ID24274
Institutional Source Beutler Lab
Gene Symbol Acp7
Ensembl Gene ENSMUSG00000037469
Gene Nameacid phosphatase 7, tartrate resistant
SynonymsPapl, C330005M16Rik
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R0172 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28607634-28631332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28615124 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 272 (N272S)
Ref Sequence ENSEMBL: ENSMUSP00000045437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040112] [ENSMUST00000159418] [ENSMUST00000159560]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040112
AA Change: N272S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045437
Gene: ENSMUSG00000037469
AA Change: N272S

DomainStartEndE-ValueType
Pfam:Pur_ac_phosph_N 90 183 2.2e-19 PFAM
Pfam:Metallophos 192 395 6.4e-27 PFAM
Pfam:Metallophos_C 420 482 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159418
Predicted Effect probably benign
Transcript: ENSMUST00000159560
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purple acid phosphatases (PAPs), including PAPL, are a family of binuclear metallohydrolases that have been identified in plants, animals, and fungi (Flanagan et al., 2006 [PubMed 16793224]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Acp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acp7 APN 7 28614697 missense possibly damaging 0.79
IGL00808:Acp7 APN 7 28614952 missense probably damaging 1.00
IGL01085:Acp7 APN 7 28611053 missense probably damaging 1.00
IGL02123:Acp7 APN 7 28629489 missense probably benign
IGL02250:Acp7 APN 7 28629710 splice site probably benign
IGL02255:Acp7 APN 7 28614723 missense probably damaging 1.00
IGL02904:Acp7 APN 7 28608003 missense probably benign 0.11
IGL03110:Acp7 APN 7 28611039 missense probably benign 0.25
R0360:Acp7 UTSW 7 28611128 splice site probably benign
R0364:Acp7 UTSW 7 28611128 splice site probably benign
R1616:Acp7 UTSW 7 28611078 missense probably damaging 1.00
R1973:Acp7 UTSW 7 28607989 missense probably damaging 1.00
R2077:Acp7 UTSW 7 28629482 missense probably damaging 1.00
R2125:Acp7 UTSW 7 28629549 missense probably damaging 0.99
R2256:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2257:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2696:Acp7 UTSW 7 28614576 missense probably benign 0.00
R3103:Acp7 UTSW 7 28610984 critical splice donor site probably null
R3753:Acp7 UTSW 7 28616660 missense probably damaging 1.00
R3833:Acp7 UTSW 7 28615094 missense probably benign 0.00
R4622:Acp7 UTSW 7 28614397 missense probably damaging 1.00
R4849:Acp7 UTSW 7 28615452 missense possibly damaging 0.82
R5364:Acp7 UTSW 7 28611023 missense probably benign 0.25
R5382:Acp7 UTSW 7 28615419 missense possibly damaging 0.80
R5665:Acp7 UTSW 7 28616543 missense probably benign 0.31
R5688:Acp7 UTSW 7 28616495 missense probably benign 0.20
R7278:Acp7 UTSW 7 28630882 missense unknown
R7295:Acp7 UTSW 7 28629530 missense possibly damaging 0.83
R7384:Acp7 UTSW 7 28615088 missense possibly damaging 0.89
R7875:Acp7 UTSW 7 28614727 missense probably damaging 1.00
R7958:Acp7 UTSW 7 28614727 missense probably damaging 1.00
RF006:Acp7 UTSW 7 28614779 missense possibly damaging 0.94
X0018:Acp7 UTSW 7 28607981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTCCAGCCAACGGAACTGC -3'
(R):5'- ATCCGGTCCTGGTTAGAGTCTCAC -3'

Sequencing Primer
(F):5'- GAACTGCTTCTCAATCAGGTGAC -3'
(R):5'- TAGCCTGAAAGTTGAGAGGC -3'
Posted On2013-04-16