Incidental Mutation 'R2275:Gm11568'
ID242745
Institutional Source Beutler Lab
Gene Symbol Gm11568
Ensembl Gene ENSMUSG00000069717
Gene Namepredicted gene 11568
Synonyms
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2275 (G1)
Quality Score115
Status Not validated
Chromosome11
Chromosomal Location99857917-99859061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99858244 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 92 (S92G)
Ref Sequence ENSEMBL: ENSMUSP00000103057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107434]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083073
Predicted Effect unknown
Transcript: ENSMUST00000107434
AA Change: S92G
SMART Domains Protein: ENSMUSP00000103057
Gene: ENSMUSG00000069717
AA Change: S92G

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 84 129 1.7e-9 PFAM
Pfam:Keratin_B2_2 103 147 7.7e-10 PFAM
Pfam:Keratin_B2_2 118 168 2.4e-6 PFAM
Pfam:Keratin_B2_2 147 189 3.8e-8 PFAM
low complexity region 195 206 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Gm11568
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:Gm11568 UTSW 11 99858383 missense unknown
R0558:Gm11568 UTSW 11 99858046 missense unknown
R1053:Gm11568 UTSW 11 99858061 missense unknown
R2273:Gm11568 UTSW 11 99858244 missense unknown
R2274:Gm11568 UTSW 11 99858244 missense unknown
R4436:Gm11568 UTSW 11 99858595 missense unknown
R4985:Gm11568 UTSW 11 99858448 missense unknown
R5078:Gm11568 UTSW 11 99858355 missense unknown
R5083:Gm11568 UTSW 11 99857972 start codon destroyed probably null
R6879:Gm11568 UTSW 11 99858227 missense unknown
R7486:Gm11568 UTSW 11 99858466 missense unknown
R7855:Gm11568 UTSW 11 99858184 missense unknown
R7938:Gm11568 UTSW 11 99858184 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCTGTGTGACCAGCTGTTG -3'
(R):5'- AGTTAATCAACAGCCACAGGGC -3'

Sequencing Primer
(F):5'- TGTCAAACCACCTGCTG -3'
(R):5'- GTAGCAAGTCCTGGTGCAG -3'
Posted On2014-10-16