Incidental Mutation 'R2275:Rptor'
ID 242747
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Name regulatory associated protein of MTOR, complex 1
Synonyms raptor, Rap, 4932417H02Rik
MMRRC Submission 040274-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2275 (G1)
Quality Score 213
Status Not validated
Chromosome 11
Chromosomal Location 119602905-119899576 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 119756322 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 246 (C246*)
Ref Sequence ENSEMBL: ENSMUSP00000124366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000147781]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000026671
AA Change: C246*
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: C246*

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147772
Predicted Effect probably null
Transcript: ENSMUST00000147781
AA Change: C246*
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583
AA Change: C246*

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119799445 missense possibly damaging 0.92
IGL01319:Rptor APN 11 119891170 missense probably benign 0.01
IGL01375:Rptor APN 11 119896436 missense possibly damaging 0.68
IGL01899:Rptor APN 11 119857453 missense probably benign 0.04
IGL01927:Rptor APN 11 119657674 missense probably damaging 1.00
IGL02312:Rptor APN 11 119846915 missense possibly damaging 0.84
IGL02620:Rptor APN 11 119780587 missense probably benign 0.12
IGL02651:Rptor APN 11 119892612 missense possibly damaging 0.69
IGL03182:Rptor APN 11 119725145 missense probably damaging 1.00
Velocipede UTSW 11 119895977 missense possibly damaging 0.92
R0103:Rptor UTSW 11 119884967 missense probably benign 0.01
R0179:Rptor UTSW 11 119872367 missense probably benign 0.14
R0217:Rptor UTSW 11 119894912 splice site probably benign
R0219:Rptor UTSW 11 119821777 intron probably benign
R0324:Rptor UTSW 11 119892641 missense probably damaging 1.00
R0432:Rptor UTSW 11 119780553 nonsense probably null
R0718:Rptor UTSW 11 119872376 missense probably benign 0.15
R0730:Rptor UTSW 11 119884954 missense probably benign 0.06
R1019:Rptor UTSW 11 119843743 missense probably damaging 1.00
R1073:Rptor UTSW 11 119743891 missense possibly damaging 0.93
R1424:Rptor UTSW 11 119780593 nonsense probably null
R1579:Rptor UTSW 11 119896001 missense probably benign 0.00
R1766:Rptor UTSW 11 119725061 missense probably damaging 0.99
R1844:Rptor UTSW 11 119756320 missense probably damaging 1.00
R2180:Rptor UTSW 11 119725144 missense probably damaging 1.00
R2274:Rptor UTSW 11 119756322 nonsense probably null
R2408:Rptor UTSW 11 119857451 missense probably damaging 0.99
R2981:Rptor UTSW 11 119865594 missense probably damaging 1.00
R2996:Rptor UTSW 11 119856298 missense probably damaging 1.00
R3001:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3002:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3003:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R4358:Rptor UTSW 11 119671345 missense probably damaging 0.98
R4592:Rptor UTSW 11 119798840 missense probably null 1.00
R4647:Rptor UTSW 11 119891163 missense probably benign 0.33
R4666:Rptor UTSW 11 119743882 missense probably damaging 1.00
R4958:Rptor UTSW 11 119857391 missense probably benign 0.29
R4974:Rptor UTSW 11 119821640 intron probably benign
R5073:Rptor UTSW 11 119896479 missense possibly damaging 0.71
R5199:Rptor UTSW 11 119603816 missense probably benign
R5216:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5219:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5277:Rptor UTSW 11 119822956 missense probably damaging 1.00
R5365:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5366:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5447:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5630:Rptor UTSW 11 119756249 missense probably benign 0.01
R6220:Rptor UTSW 11 119897442 missense possibly damaging 0.83
R6567:Rptor UTSW 11 119896012 missense probably benign 0.00
R6741:Rptor UTSW 11 119895977 missense possibly damaging 0.92
R6915:Rptor UTSW 11 119756345 missense probably damaging 0.99
R7032:Rptor UTSW 11 119846936 missense probably benign 0.00
R7051:Rptor UTSW 11 119874186 utr 3 prime probably benign
R7396:Rptor UTSW 11 119872355 missense probably benign 0.10
R7429:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7430:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7447:Rptor UTSW 11 119884979 missense probably benign 0.00
R7595:Rptor UTSW 11 119743953 missense possibly damaging 0.82
R7776:Rptor UTSW 11 119892627 missense probably benign 0.01
R7854:Rptor UTSW 11 119857953 missense probably benign 0.02
R8288:Rptor UTSW 11 119857937 missense probably benign 0.02
R8305:Rptor UTSW 11 119811986 missense probably damaging 1.00
R8328:Rptor UTSW 11 119892647 missense probably benign 0.00
R8351:Rptor UTSW 11 119892639 missense probably benign 0.22
R8772:Rptor UTSW 11 119725032 missense probably damaging 1.00
R8871:Rptor UTSW 11 119603925 missense probably benign 0.01
R8925:Rptor UTSW 11 119891210 missense probably benign 0.11
R8927:Rptor UTSW 11 119891210 missense probably benign 0.11
R8981:Rptor UTSW 11 119843682 missense possibly damaging 0.90
R9149:Rptor UTSW 11 119887070 missense probably benign 0.05
R9213:Rptor UTSW 11 119603939 missense probably benign
R9224:Rptor UTSW 11 119894287 missense probably benign 0.11
R9290:Rptor UTSW 11 119811997 missense probably benign 0.00
R9314:Rptor UTSW 11 119895946 missense probably benign 0.43
R9371:Rptor UTSW 11 119671326 missense possibly damaging 0.66
R9719:Rptor UTSW 11 119891114 missense probably benign 0.13
R9751:Rptor UTSW 11 119887138 missense probably benign 0.02
X0050:Rptor UTSW 11 119846405 missense probably benign 0.14
X0066:Rptor UTSW 11 119857866 missense probably benign 0.31
Z0001:Rptor UTSW 11 119603972 critical splice donor site probably null
Z0001:Rptor UTSW 11 119756236 splice site probably null
Z0001:Rptor UTSW 11 119756415 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119799319 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119846752 critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119851468 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119857453 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119871492 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119874151 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119896549 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TTACCACCATGCGTGTTGG -3'
(R):5'- CAAAACACAGGGCACTCTGTTG -3'

Sequencing Primer
(F):5'- AAGCTTTGTCTGGGGCAGAAC -3'
(R):5'- CACTCTGTTGTGACCAGGATAATGC -3'
Posted On 2014-10-16