Incidental Mutation 'R2275:Atxn7'
ID 242753
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Name ataxin 7
Synonyms A430107N12Rik, ataxin-7, Sca7
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2275 (G1)
Quality Score 181
Status Not validated
Chromosome 14
Chromosomal Location 13961440-14107302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14013268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 62 (M62K)
Ref Sequence ENSEMBL: ENSMUSP00000153613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
AlphaFold Q8R4I1
Predicted Effect possibly damaging
Transcript: ENSMUST00000022257
AA Change: M62K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: M62K

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223714
AA Change: M62K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223880
AA Change: M62K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226073
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14096324 splice site probably benign
IGL00782:Atxn7 APN 14 14096218 missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14100105 missense probably benign 0.00
IGL02828:Atxn7 APN 14 14090056 missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14100734 missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14052994 missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14100564 missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14087273 splice site probably benign
Estes_park UTSW 14 14096317 critical splice donor site probably null
Lumpy UTSW 14 14089446 nonsense probably null
Oestes_park UTSW 14 14096268 nonsense probably null
R0034:Atxn7 UTSW 14 14100846 missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14100317 missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14089465 splice site probably benign
R1169:Atxn7 UTSW 14 14095468 missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14096239 missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14089419 missense probably benign 0.25
R2078:Atxn7 UTSW 14 14052975 missense probably damaging 0.99
R2394:Atxn7 UTSW 14 14100237 missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14100308 missense probably benign 0.00
R4230:Atxn7 UTSW 14 14100381 missense probably benign 0.00
R4588:Atxn7 UTSW 14 14096268 nonsense probably null
R4688:Atxn7 UTSW 14 14089288 missense probably benign 0.00
R4935:Atxn7 UTSW 14 14100401 missense probably benign
R5041:Atxn7 UTSW 14 14096317 critical splice donor site probably null
R5185:Atxn7 UTSW 14 14090063 missense probably benign 0.04
R5561:Atxn7 UTSW 14 14089260 missense probably benign 0.19
R5641:Atxn7 UTSW 14 14013638 missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14089446 nonsense probably null
R6549:Atxn7 UTSW 14 14013087 missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14099972 missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14095511 missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14100878 missense probably benign 0.08
R7402:Atxn7 UTSW 14 14095427 missense probably damaging 0.98
R7762:Atxn7 UTSW 14 14100467 missense probably damaging 1.00
R8432:Atxn7 UTSW 14 14013635 missense probably benign 0.06
R8786:Atxn7 UTSW 14 14103316 missense possibly damaging 0.78
R9238:Atxn7 UTSW 14 14089441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTTACATTGTAGGAGCGGAAAG -3'
(R):5'- GAAGATAGCATCTCTGACCCC -3'

Sequencing Primer
(F):5'- TACATTGTAGGAGCGGAAAGAATGTC -3'
(R):5'- ATCTCTGACCCCCGTGG -3'
Posted On 2014-10-16