Incidental Mutation 'R2275:Ppl'
ID242760
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Nameperiplakin
Synonyms
MMRRC Submission 040274-MU
Accession Numbers

Genbank: NM_008909

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2275 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location5086291-5132421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5094552 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 722 (S722G)
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672]
Predicted Effect probably benign
Transcript: ENSMUST00000035672
AA Change: S722G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: S722G

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230554
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 5089545 missense probably benign 0.41
IGL00484:Ppl APN 16 5087952 missense probably benign 0.13
IGL00654:Ppl APN 16 5087308 missense possibly damaging 0.94
IGL00832:Ppl APN 16 5088975 missense probably damaging 1.00
IGL01104:Ppl APN 16 5094491 missense probably benign 0.01
IGL01327:Ppl APN 16 5087644 missense probably benign 0.19
IGL01644:Ppl APN 16 5091855 missense probably damaging 1.00
IGL01824:Ppl APN 16 5087889 missense probably damaging 1.00
IGL02071:Ppl APN 16 5113072 missense probably benign 0.04
IGL02085:Ppl APN 16 5089816 missense probably benign 0.09
IGL02282:Ppl APN 16 5101458 missense probably damaging 1.00
IGL02635:Ppl APN 16 5089767 missense probably benign 0.01
IGL02649:Ppl APN 16 5087463 missense probably damaging 1.00
IGL02888:Ppl APN 16 5100407 missense possibly damaging 0.89
IGL03305:Ppl APN 16 5093233 missense possibly damaging 0.62
G4846:Ppl UTSW 16 5087206 missense probably damaging 1.00
IGL03097:Ppl UTSW 16 5096726 missense probably damaging 0.98
R0759:Ppl UTSW 16 5089777 missense probably benign 0.00
R0786:Ppl UTSW 16 5089054 missense probably damaging 1.00
R1024:Ppl UTSW 16 5100000 missense probably damaging 1.00
R1498:Ppl UTSW 16 5104765 missense probably benign 0.05
R1544:Ppl UTSW 16 5102597 nonsense probably null
R1597:Ppl UTSW 16 5107574 missense probably benign 0.20
R1863:Ppl UTSW 16 5087980 missense possibly damaging 0.69
R1921:Ppl UTSW 16 5106124 missense possibly damaging 0.80
R2230:Ppl UTSW 16 5088981 missense possibly damaging 0.51
R2355:Ppl UTSW 16 5094497 missense probably benign 0.00
R3410:Ppl UTSW 16 5107517 missense possibly damaging 0.81
R3737:Ppl UTSW 16 5106857 missense probably benign
R3797:Ppl UTSW 16 5104550 splice site probably benign
R3968:Ppl UTSW 16 5100332 splice site probably null
R3970:Ppl UTSW 16 5100332 splice site probably null
R4034:Ppl UTSW 16 5106857 missense probably benign
R4583:Ppl UTSW 16 5104536 missense probably benign 0.02
R4639:Ppl UTSW 16 5089446 missense probably damaging 1.00
R4762:Ppl UTSW 16 5088982 missense probably benign 0.00
R4828:Ppl UTSW 16 5104926 missense probably damaging 1.00
R4869:Ppl UTSW 16 5104889 missense probably damaging 0.99
R4925:Ppl UTSW 16 5104982 missense probably damaging 1.00
R4983:Ppl UTSW 16 5088718 missense possibly damaging 0.75
R4984:Ppl UTSW 16 5087641 missense probably benign
R4997:Ppl UTSW 16 5089371 missense probably damaging 1.00
R5072:Ppl UTSW 16 5088878 missense probably benign 0.01
R5073:Ppl UTSW 16 5088878 missense probably benign 0.01
R5074:Ppl UTSW 16 5088878 missense probably benign 0.01
R5286:Ppl UTSW 16 5089123 nonsense probably null
R5398:Ppl UTSW 16 5104922 missense probably benign 0.00
R5448:Ppl UTSW 16 5107566 missense probably benign
R5664:Ppl UTSW 16 5106055 missense probably benign 0.00
R5873:Ppl UTSW 16 5106049 critical splice donor site probably null
R5918:Ppl UTSW 16 5104901 missense probably benign 0.00
R5951:Ppl UTSW 16 5088628 missense probably benign 0.25
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6088:Ppl UTSW 16 5104988 missense possibly damaging 0.73
R6149:Ppl UTSW 16 5107596 nonsense probably null
R6358:Ppl UTSW 16 5087929 nonsense probably null
R6379:Ppl UTSW 16 5097691 missense probably benign 0.02
R6468:Ppl UTSW 16 5092441 missense probably damaging 1.00
R6514:Ppl UTSW 16 5087317 missense probably damaging 1.00
R6528:Ppl UTSW 16 5087616 missense probably benign 0.00
R6703:Ppl UTSW 16 5089464 missense probably damaging 0.99
R6721:Ppl UTSW 16 5107469 missense probably damaging 0.97
R6811:Ppl UTSW 16 5089144 missense probably damaging 0.99
R6934:Ppl UTSW 16 5094509 missense probably benign 0.00
R7034:Ppl UTSW 16 5087502 missense probably benign 0.29
R7076:Ppl UTSW 16 5100119 missense probably damaging 1.00
R7300:Ppl UTSW 16 5102371 missense possibly damaging 0.87
R7349:Ppl UTSW 16 5104729 missense probably damaging 0.99
R7359:Ppl UTSW 16 5089341 missense possibly damaging 0.78
R7378:Ppl UTSW 16 5112996 missense possibly damaging 0.91
R7383:Ppl UTSW 16 5097971 missense probably damaging 1.00
R7389:Ppl UTSW 16 5106713 intron probably null
R7445:Ppl UTSW 16 5089068 missense probably damaging 1.00
R7687:Ppl UTSW 16 5097942 missense probably benign 0.00
R7752:Ppl UTSW 16 5102302 missense probably benign 0.09
R7827:Ppl UTSW 16 5087964 missense probably damaging 1.00
RF009:Ppl UTSW 16 5097931 missense probably benign 0.00
X0054:Ppl UTSW 16 5104902 missense probably benign 0.00
Z1088:Ppl UTSW 16 5089507 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCTGATGCTCCCAGACATACA -3'
(R):5'- ATTCTGTGGGGCTTACTGGC -3'

Sequencing Primer
(F):5'- GATGCTCCCAGACATACATTACAAAG -3'
(R):5'- GCTTACTGGCCAGTCAATCTGAC -3'
Posted On2014-10-16