Mutagenetix > Incidental Mutations

Incidental Mutation 'R2275:Ppl'

242760

Institutional Source

Beutler Lab

Gene Symbol

Ppl

Ensembl Gene

ENSMUSG00000039457

Gene Name

periplakin

Synonyms

MMRRC Submission

040274-MU

Accession Numbers

Genbank: NM_008909

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2275 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5086291-5132421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5094552 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 722 (S722G)

Ref Sequence

ENSEMBL: ENSMUSP00000039360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035672]

Predicted Effect

probably benign
Transcript: ENSMUST00000035672
AA Change: S722G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: S722G

Domain	Start	End	E-Value	Type
SPEC	123	211	1.58e0	SMART
SPEC	214	315	3.38e-2	SMART
SPEC	321	483	1.11e-2	SMART
SPEC	503	610	4.96e0	SMART
Blast:SPEC	613	717	5e-59	BLAST
low complexity region	718	729	N/A	INTRINSIC
Blast:SPEC	732	859	2e-60	BLAST
low complexity region	893	908	N/A	INTRINSIC
low complexity region	963	982	N/A	INTRINSIC
internal_repeat_2	984	1004	3.46e-5	PROSPERO
internal_repeat_1	992	1008	8.09e-7	PROSPERO
low complexity region	1011	1020	N/A	INTRINSIC
low complexity region	1027	1042	N/A	INTRINSIC
internal_repeat_1	1112	1128	8.09e-7	PROSPERO
coiled coil region	1180	1279	N/A	INTRINSIC
low complexity region	1346	1355	N/A	INTRINSIC
low complexity region	1386	1433	N/A	INTRINSIC
low complexity region	1455	1479	N/A	INTRINSIC
Blast:SPEC	1529	1610	8e-30	BLAST
low complexity region	1612	1630	N/A	INTRINSIC
PLEC	1649	1683	1.34e-5	SMART
PLEC	1698	1733	2.23e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230554

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	A	G	3: 108,542,503	N33D	possibly damaging	Het
2300003K06Rik	A	T	11: 99,837,841	C59S	possibly damaging	Het
Abca5	A	T	11: 110,275,281	N1556K	possibly damaging	Het
Ackr1	T	C	1: 173,332,485	N156D	probably benign	Het
Aco2	C	T	15: 81,895,264	R57C	probably benign	Het
Adamtsl3	A	T	7: 82,606,558	S1593C	probably benign	Het
Adgrb2	G	A	4: 130,006,854	G333D	probably damaging	Het
Arhgef7	T	A	8: 11,815,010	F374Y	possibly damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Atxn7	T	A	14: 14,013,268	M62K	possibly damaging	Het
C87436	G	A	6: 86,445,600	R52H	probably damaging	Het
Cacna1g	T	A	11: 94,415,936	E1842V	probably damaging	Het
Cdh4	T	C	2: 179,890,847	S701P	probably damaging	Het
Cdr2	A	T	7: 120,958,509	H264Q	possibly damaging	Het
Cecr2	C	T	6: 120,756,741	S563L	probably benign	Het
Col12a1	A	T	9: 79,635,427	V2352E	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csad	G	T	15: 102,187,122	R167S	probably damaging	Het
Dnlz	A	T	2: 26,351,471	C82S	probably damaging	Het
Ehmt2	T	A	17: 34,910,715	N951K	possibly damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Enpp2	A	C	15: 54,897,794	Y221D	probably damaging	Het
Exoc3l	A	T	8: 105,290,447		probably null	Het
F11	T	C	8: 45,252,147	D119G	possibly damaging	Het
Faiml	T	C	9: 99,229,559	Y149C	probably benign	Het
Fn1	C	T	1: 71,613,943	G1296R	probably null	Het
Glg1	A	T	8: 111,168,721	Y819*	probably null	Het
Gm11568	A	G	11: 99,858,244	S92G	unknown	Het
Gm28042	A	C	2: 120,036,829	Q465P	probably damaging	Het
Gpatch1	A	T	7: 35,288,678	S678T	probably benign	Het
Gpr158	A	T	2: 21,826,863	M925L	probably benign	Het
Hecw1	T	C	13: 14,346,068	T195A	probably benign	Het
Hoxd1	A	G	2: 74,764,157	K252R	probably damaging	Het
Iqck	G	A	7: 118,899,657	D173N	possibly damaging	Het
Kcnh1	T	G	1: 192,337,521	V358G	probably damaging	Het
Kifap3	T	A	1: 163,868,758	V652D	possibly damaging	Het
Knl1	C	A	2: 119,072,281	Q1488K	probably damaging	Het
Map4k1	T	A	7: 29,001,957	H729Q	probably damaging	Het
March1	T	A	8: 66,387,499	N311K	probably benign	Het
Mypn	A	G	10: 63,131,069	F943L	probably damaging	Het
Nkpd1	A	G	7: 19,523,897	I534V	probably benign	Het
Nrarp	T	C	2: 25,181,409	V100A	possibly damaging	Het
Nt5c1a	T	C	4: 123,216,080	F324S	probably damaging	Het
Ntrk2	T	A	13: 58,861,351	Y319N	probably damaging	Het
Olfr1170	A	G	2: 88,224,823	F70L	probably benign	Het
Parg	A	G	14: 32,295,238	D384G	probably damaging	Het
Pde7b	T	A	10: 20,400,419	*460L	probably null	Het
Pigr	G	T	1: 130,846,470	V396L	probably benign	Het
Pkhd1	A	G	1: 20,200,849	I3160T	possibly damaging	Het
Ppp1r26	A	G	2: 28,452,701	E781G	possibly damaging	Het
Rptor	T	A	11: 119,756,322	C246*	probably null	Het
Rusc2	G	A	4: 43,416,260	R522H	probably damaging	Het
Senp7	T	C	16: 56,184,783	S927P	probably damaging	Het
Serpinb6d	A	T	13: 33,671,428	M362L	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slc12a3	T	A	8: 94,333,287	I187N	possibly damaging	Het
Slc46a1	T	G	11: 78,466,423	S101A	probably benign	Het
Slc4a8	A	G	15: 100,807,402	M830V	probably benign	Het
Slco4a1	T	C	2: 180,464,736	L237P	possibly damaging	Het
Sned1	T	A	1: 93,281,642		probably null	Het
Tia1	A	G	6: 86,427,677	N298S	probably benign	Het
Tsr1	A	T	11: 74,904,827		probably null	Het
Ttc6	G	A	12: 57,702,298	V1339I	probably benign	Het
Tyrp1	A	T	4: 80,837,534	E180V	probably damaging	Het
Ubr3	T	C	2: 70,016,341	V1636A	probably benign	Het
Usp1	T	C	4: 98,929,842	L139P	probably damaging	Het
Vmn1r228	A	G	17: 20,776,545	L237P	probably damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Vmn2r2	T	C	3: 64,116,509	R884G	probably benign	Het
Vmn2r60	T	A	7: 42,136,827	Y351*	probably null	Het
Zbtb7a	G	A	10: 81,144,997	V342I	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,752	N127K	probably damaging	Het

Other mutations in Ppl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ppl	APN	16	5089545	missense	probably benign	0.41
IGL00484:Ppl	APN	16	5087952	missense	probably benign	0.13
IGL00654:Ppl	APN	16	5087308	missense	possibly damaging	0.94
IGL00832:Ppl	APN	16	5088975	missense	probably damaging	1.00
IGL01104:Ppl	APN	16	5094491	missense	probably benign	0.01
IGL01327:Ppl	APN	16	5087644	missense	probably benign	0.19
IGL01644:Ppl	APN	16	5091855	missense	probably damaging	1.00
IGL01824:Ppl	APN	16	5087889	missense	probably damaging	1.00
IGL02071:Ppl	APN	16	5113072	missense	probably benign	0.04
IGL02085:Ppl	APN	16	5089816	missense	probably benign	0.09
IGL02282:Ppl	APN	16	5101458	missense	probably damaging	1.00
IGL02635:Ppl	APN	16	5089767	missense	probably benign	0.01
IGL02649:Ppl	APN	16	5087463	missense	probably damaging	1.00
IGL02888:Ppl	APN	16	5100407	missense	possibly damaging	0.89
IGL03305:Ppl	APN	16	5093233	missense	possibly damaging	0.62
G4846:Ppl	UTSW	16	5087206	missense	probably damaging	1.00
IGL03097:Ppl	UTSW	16	5096726	missense	probably damaging	0.98
R0759:Ppl	UTSW	16	5089777	missense	probably benign	0.00
R0786:Ppl	UTSW	16	5089054	missense	probably damaging	1.00
R1024:Ppl	UTSW	16	5100000	missense	probably damaging	1.00
R1498:Ppl	UTSW	16	5104765	missense	probably benign	0.05
R1544:Ppl	UTSW	16	5102597	nonsense	probably null
R1597:Ppl	UTSW	16	5107574	missense	probably benign	0.20
R1863:Ppl	UTSW	16	5087980	missense	possibly damaging	0.69
R1921:Ppl	UTSW	16	5106124	missense	possibly damaging	0.80
R2230:Ppl	UTSW	16	5088981	missense	possibly damaging	0.51
R2355:Ppl	UTSW	16	5094497	missense	probably benign	0.00
R3410:Ppl	UTSW	16	5107517	missense	possibly damaging	0.81
R3737:Ppl	UTSW	16	5106857	missense	probably benign
R3797:Ppl	UTSW	16	5104550	splice site	probably benign
R3968:Ppl	UTSW	16	5100332	splice site	probably null
R3970:Ppl	UTSW	16	5100332	splice site	probably null
R4034:Ppl	UTSW	16	5106857	missense	probably benign
R4583:Ppl	UTSW	16	5104536	missense	probably benign	0.02
R4639:Ppl	UTSW	16	5089446	missense	probably damaging	1.00
R4762:Ppl	UTSW	16	5088982	missense	probably benign	0.00
R4828:Ppl	UTSW	16	5104926	missense	probably damaging	1.00
R4869:Ppl	UTSW	16	5104889	missense	probably damaging	0.99
R4925:Ppl	UTSW	16	5104982	missense	probably damaging	1.00
R4983:Ppl	UTSW	16	5088718	missense	possibly damaging	0.75
R4984:Ppl	UTSW	16	5087641	missense	probably benign
R4997:Ppl	UTSW	16	5089371	missense	probably damaging	1.00
R5072:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5073:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5074:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5286:Ppl	UTSW	16	5089123	nonsense	probably null
R5398:Ppl	UTSW	16	5104922	missense	probably benign	0.00
R5448:Ppl	UTSW	16	5107566	missense	probably benign
R5664:Ppl	UTSW	16	5106055	missense	probably benign	0.00
R5873:Ppl	UTSW	16	5106049	critical splice donor site	probably null
R5918:Ppl	UTSW	16	5104901	missense	probably benign	0.00
R5951:Ppl	UTSW	16	5088628	missense	probably benign	0.25
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6088:Ppl	UTSW	16	5104988	missense	possibly damaging	0.73
R6149:Ppl	UTSW	16	5107596	nonsense	probably null
R6358:Ppl	UTSW	16	5087929	nonsense	probably null
R6379:Ppl	UTSW	16	5097691	missense	probably benign	0.02
R6468:Ppl	UTSW	16	5092441	missense	probably damaging	1.00
R6514:Ppl	UTSW	16	5087317	missense	probably damaging	1.00
R6528:Ppl	UTSW	16	5087616	missense	probably benign	0.00
R6703:Ppl	UTSW	16	5089464	missense	probably damaging	0.99
R6721:Ppl	UTSW	16	5107469	missense	probably damaging	0.97
R6811:Ppl	UTSW	16	5089144	missense	probably damaging	0.99
R6934:Ppl	UTSW	16	5094509	missense	probably benign	0.00
R7034:Ppl	UTSW	16	5087502	missense	probably benign	0.29
R7076:Ppl	UTSW	16	5100119	missense	probably damaging	1.00
R7300:Ppl	UTSW	16	5102371	missense	possibly damaging	0.87
R7349:Ppl	UTSW	16	5104729	missense	probably damaging	0.99
R7359:Ppl	UTSW	16	5089341	missense	possibly damaging	0.78
R7378:Ppl	UTSW	16	5112996	missense	possibly damaging	0.91
R7383:Ppl	UTSW	16	5097971	missense	probably damaging	1.00
R7389:Ppl	UTSW	16	5106713	intron	probably null
R7445:Ppl	UTSW	16	5089068	missense	probably damaging	1.00
R7687:Ppl	UTSW	16	5097942	missense	probably benign	0.00
R7752:Ppl	UTSW	16	5102302	missense	probably benign	0.09
R7827:Ppl	UTSW	16	5087964	missense	probably damaging	1.00
RF009:Ppl	UTSW	16	5097931	missense	probably benign	0.00
X0054:Ppl	UTSW	16	5104902	missense	probably benign	0.00
Z1088:Ppl	UTSW	16	5089507	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTCTGATGCTCCCAGACATACA -3'
(R):5'- ATTCTGTGGGGCTTACTGGC -3'

Sequencing Primer
(F):5'- GATGCTCCCAGACATACATTACAAAG -3'
(R):5'- GCTTACTGGCCAGTCAATCTGAC -3'

Posted On

2014-10-16