Incidental Mutation 'R2275:Ehmt2'
ID242766
Institutional Source Beutler Lab
Gene Symbol Ehmt2
Ensembl Gene ENSMUSG00000013787
Gene Nameeuchromatic histone lysine N-methyltransferase 2
SynonymsNG36, D17Ertd710e, G9a, KMT1C, Bat8
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2275 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34898469-34914052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34910715 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 951 (N951K)
Ref Sequence ENSEMBL: ENSMUSP00000094955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000013931] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000124846] [ENSMUST00000137071]
Predicted Effect probably benign
Transcript: ENSMUST00000007249
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000013931
AA Change: N985K

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787
AA Change: N985K

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078061
AA Change: N894K

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787
AA Change: N894K

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097342
AA Change: N951K

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787
AA Change: N951K

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114033
AA Change: N928K

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787
AA Change: N928K

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124002
Predicted Effect probably benign
Transcript: ENSMUST00000124846
SMART Domains Protein: ENSMUSP00000121838
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 115 138 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
ANK 258 287 2.52e-6 SMART
ANK 291 320 1.19e-2 SMART
ANK 324 354 4.71e-6 SMART
ANK 358 387 2.9e-6 SMART
ANK 391 420 1e0 SMART
Pfam:Ank 424 442 3.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131915
Predicted Effect probably benign
Transcript: ENSMUST00000137071
SMART Domains Protein: ENSMUSP00000134749
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 23 52 1.19e-2 SMART
ANK 56 86 4.71e-6 SMART
ANK 90 119 2.9e-6 SMART
low complexity region 143 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150786
Predicted Effect probably benign
Transcript: ENSMUST00000172921
SMART Domains Protein: ENSMUSP00000134089
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 24 53 1.19e-2 SMART
ANK 57 87 4.71e-6 SMART
ANK 89 118 1e0 SMART
ANK 122 151 1.53e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E9.5-E12.5. Mutant embryos are developmentally delayed. Conditional deletion in germ cells results in infertility and arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Adgrb2 G A 4: 130,006,854 G333D probably damaging Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Ehmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ehmt2 APN 17 34910815 missense probably damaging 1.00
IGL02398:Ehmt2 APN 17 34908479 missense probably damaging 1.00
IGL02878:Ehmt2 APN 17 34910767 missense probably damaging 1.00
IGL02928:Ehmt2 APN 17 34910822 missense probably damaging 1.00
IGL03117:Ehmt2 APN 17 34906811 missense possibly damaging 0.54
R0630:Ehmt2 UTSW 17 34899842 missense probably benign 0.02
R0778:Ehmt2 UTSW 17 34905418 missense probably damaging 0.99
R0909:Ehmt2 UTSW 17 34906504 missense possibly damaging 0.95
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1693:Ehmt2 UTSW 17 34906410 missense possibly damaging 0.88
R1855:Ehmt2 UTSW 17 34910776 missense probably damaging 1.00
R2212:Ehmt2 UTSW 17 34899365 missense probably benign
R3761:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R3827:Ehmt2 UTSW 17 34906765 missense possibly damaging 0.95
R3915:Ehmt2 UTSW 17 34903467 missense probably damaging 0.99
R4303:Ehmt2 UTSW 17 34908748 missense possibly damaging 0.92
R4529:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R4651:Ehmt2 UTSW 17 34913814 missense probably damaging 1.00
R4825:Ehmt2 UTSW 17 34906964 missense probably benign
R5061:Ehmt2 UTSW 17 34899091 nonsense probably null
R5158:Ehmt2 UTSW 17 34911664 missense probably damaging 1.00
R5298:Ehmt2 UTSW 17 34899091 nonsense probably null
R5299:Ehmt2 UTSW 17 34899091 nonsense probably null
R5523:Ehmt2 UTSW 17 34899091 nonsense probably null
R5524:Ehmt2 UTSW 17 34899091 nonsense probably null
R5727:Ehmt2 UTSW 17 34906032 missense possibly damaging 0.75
R5755:Ehmt2 UTSW 17 34908238 missense probably benign 0.05
R5786:Ehmt2 UTSW 17 34910743 missense probably damaging 1.00
R5951:Ehmt2 UTSW 17 34899381 missense probably benign
R6036:Ehmt2 UTSW 17 34899091 nonsense probably null
R6162:Ehmt2 UTSW 17 34899091 nonsense probably null
R6708:Ehmt2 UTSW 17 34899899 nonsense probably null
R6889:Ehmt2 UTSW 17 34912772 missense probably damaging 1.00
R6943:Ehmt2 UTSW 17 34911430 missense probably damaging 1.00
R7470:Ehmt2 UTSW 17 34899396 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTAGCCGAGATTGTTCTCCG -3'
(R):5'- TGTTCCAGGACAGTGAGTGG -3'

Sequencing Primer
(F):5'- CCGAGATTGTTCTCCGTGGTG -3'
(R):5'- AGGGGGAGTCTTCATGCC -3'
Posted On2014-10-16