Incidental Mutation 'R2276:Fam178b'
ID242769
Institutional Source Beutler Lab
Gene Symbol Fam178b
Ensembl Gene ENSMUSG00000046337
Gene Namefamily with sequence similarity 178, member B
Synonyms1700024G10Rik, LOC381337
MMRRC Submission 040275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2276 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36562692-36683183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36632458 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 194 (L194P)
Ref Sequence ENSEMBL: ENSMUSP00000124023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114981] [ENSMUST00000170295]
Predicted Effect probably damaging
Transcript: ENSMUST00000114981
AA Change: L194P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124023
Gene: ENSMUSG00000046337
AA Change: L194P

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 89 371 3.4e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170295
AA Change: L194P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132846
Gene: ENSMUSG00000046337
AA Change: L194P

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 86 385 1e-130 PFAM
low complexity region 395 410 N/A INTRINSIC
Meta Mutation Damage Score 0.4003 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Ankrd27 T C 7: 35,615,840 probably benign Het
Anxa3 T C 5: 96,830,490 probably null Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cep112 A T 11: 108,855,845 R176S probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cpped1 A C 16: 11,894,881 probably null Het
Cr2 T C 1: 195,157,368 R960G possibly damaging Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dnah6 G A 6: 73,113,581 S2210L probably benign Het
Dnajb12 C T 10: 59,892,977 T229I probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Epb41l2 T C 10: 25,488,944 probably benign Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gimap9 A G 6: 48,677,878 H133R probably benign Het
Gpbp1 A T 13: 111,466,978 probably null Het
Gpr89 A G 3: 96,897,427 Y38H probably damaging Het
Gsdmc3 T A 15: 63,860,256 Y307F probably benign Het
Hip1 C T 5: 135,457,046 R101K probably damaging Het
Hist4h4 T A 6: 136,804,301 I27F probably damaging Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Igfn1 T C 1: 135,964,741 K2214E probably damaging Het
Itgal A T 7: 127,328,747 E1038V probably null Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kctd15 T C 7: 34,644,941 D95G possibly damaging Het
Kif1a A T 1: 93,068,477 probably benign Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lrrc7 A G 3: 158,179,792 F432L probably damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Nisch T C 14: 31,176,846 probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Osbpl2 G A 2: 180,148,526 G198S possibly damaging Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Ptpn4 T C 1: 119,684,591 D24G probably damaging Het
Rars2 T C 4: 34,656,835 S495P probably damaging Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rhou T C 8: 123,655,519 V100A probably damaging Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Scmh1 G T 4: 120,483,672 C185F probably damaging Het
Sema3d A T 5: 12,542,582 Q326L possibly damaging Het
Sis T A 3: 72,914,601 K1376* probably null Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc26a5 A G 5: 21,823,547 V304A probably benign Het
Slc39a7 C T 17: 34,031,267 probably benign Het
Slco1a4 A G 6: 141,815,582 V435A possibly damaging Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tgm5 T A 2: 121,048,823 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem132d G A 5: 127,795,923 R541W probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tpbgl G T 7: 99,626,026 A208E possibly damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Ulk1 T C 5: 110,788,162 E827G probably benign Het
Vps13a A G 19: 16,710,426 V886A possibly damaging Het
Wrn A T 8: 33,324,556 C44S probably benign Het
Zscan22 T A 7: 12,906,823 C331* probably null Het
Other mutations in Fam178b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Fam178b APN 1 36564403 missense possibly damaging 0.90
IGL01128:Fam178b APN 1 36644354 missense probably damaging 1.00
IGL01859:Fam178b APN 1 36659365 missense probably damaging 1.00
R0398:Fam178b UTSW 1 36632406 splice site probably benign
R1116:Fam178b UTSW 1 36578588 nonsense probably null
R1613:Fam178b UTSW 1 36600192 missense probably benign 0.01
R1623:Fam178b UTSW 1 36644324 missense probably damaging 1.00
R3706:Fam178b UTSW 1 36608448 missense probably damaging 1.00
R4535:Fam178b UTSW 1 36600525 missense probably benign 0.43
R4784:Fam178b UTSW 1 36632415 splice site probably null
R5372:Fam178b UTSW 1 36564848 missense possibly damaging 0.95
R5431:Fam178b UTSW 1 36632485 missense probably damaging 1.00
R6808:Fam178b UTSW 1 36600135 missense probably damaging 1.00
R7117:Fam178b UTSW 1 36600467 missense probably benign 0.04
R7308:Fam178b UTSW 1 36659407 missense probably benign
R7573:Fam178b UTSW 1 36632452 missense probably damaging 1.00
R7678:Fam178b UTSW 1 36564451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCTTGTCACTAACACTGGAG -3'
(R):5'- TGGAAGCATTAAGATGAGTCCTG -3'

Sequencing Primer
(F):5'- GACAGAGCCAAAGATGTGTGGC -3'
(R):5'- GCTTGGCTAAAAGAGATCCTGTC -3'
Posted On2014-10-16