Mutagenetix > Incidental Mutation

Incidental Mutation 'R2276:Cr2'

242774

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

040275-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R2276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 195157368 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 960 (R960G)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000082321
AA Change: R584G

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: R584G

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193356
AA Change: R287G

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: R287G

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195120
AA Change: R584G

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: R584G

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210219
AA Change: R960G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.2269

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	A	14: 78,510,037	I1637L	possibly damaging	Het
Ankrd27	T	C	7: 35,615,840		probably benign	Het
Anxa3	T	C	5: 96,830,490		probably null	Het
Arfgef2	G	C	2: 166,865,759	G1025A	probably benign	Het
Arhgap21	T	C	2: 20,863,226	I829V	possibly damaging	Het
Arhgap42	T	C	9: 9,035,511	M277V	probably benign	Het
Cep112	A	T	11: 108,855,845	R176S	probably damaging	Het
Chd9	C	T	8: 91,033,987	P2120L	probably benign	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cpped1	A	C	16: 11,894,881		probably null	Het
Dbf4	T	C	5: 8,421,333	N36S	possibly damaging	Het
Dnah6	G	A	6: 73,113,581	S2210L	probably benign	Het
Dnajb12	C	T	10: 59,892,977	T229I	probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Epb41l2	T	C	10: 25,488,944		probably benign	Het
Fam178b	A	G	1: 36,632,458	L194P	probably damaging	Het
Fam50b	C	T	13: 34,746,840	Q100*	probably null	Het
Gimap9	A	G	6: 48,677,878	H133R	probably benign	Het
Gpbp1	A	T	13: 111,466,978		probably null	Het
Gpr89	A	G	3: 96,897,427	Y38H	probably damaging	Het
Gsdmc3	T	A	15: 63,860,256	Y307F	probably benign	Het
Hip1	C	T	5: 135,457,046	R101K	probably damaging	Het
Hist4h4	T	A	6: 136,804,301	I27F	probably damaging	Het
Hsf4	G	A	8: 105,269,996	D18N	probably null	Het
Igfn1	T	C	1: 135,964,741	K2214E	probably damaging	Het
Itgal	A	T	7: 127,328,747	E1038V	probably null	Het
Kank2	C	A	9: 21,769,784	M816I	probably damaging	Het
Kctd15	T	C	7: 34,644,941	D95G	possibly damaging	Het
Kif1a	A	T	1: 93,068,477		probably benign	Het
Lgi4	T	G	7: 31,060,612	L78V	probably damaging	Het
Lrrc7	A	G	3: 158,179,792	F432L	probably damaging	Het
Madd	A	T	2: 91,143,683	C1419S	possibly damaging	Het
Nisch	T	C	14: 31,176,846		probably benign	Het
Olfr93	A	T	17: 37,151,254	C239*	probably null	Het
Osbpl2	G	A	2: 180,148,526	G198S	possibly damaging	Het
Pclo	T	A	5: 14,714,273	D4253E	unknown	Het
Phactr1	A	T	13: 43,077,789	S244C	possibly damaging	Het
Pja2	T	C	17: 64,292,870	S478G	probably damaging	Het
Prex1	A	T	2: 166,577,955	I79N	probably benign	Het
Ptpn4	T	C	1: 119,684,591	D24G	probably damaging	Het
Rars2	T	C	4: 34,656,835	S495P	probably damaging	Het
Rhebl1	A	T	15: 98,878,286	D162E	probably benign	Het
Rhou	T	C	8: 123,655,519	V100A	probably damaging	Het
Rpn2	A	G	2: 157,310,288	T394A	possibly damaging	Het
Ryr3	A	T	2: 112,649,319	M4386K	possibly damaging	Het
Scmh1	G	T	4: 120,483,672	C185F	probably damaging	Het
Sema3d	A	T	5: 12,542,582	Q326L	possibly damaging	Het
Sis	T	A	3: 72,914,601	K1376*	probably null	Het
Slc25a29	T	C	12: 108,826,926	E242G	probably benign	Het
Slc26a5	A	G	5: 21,823,547	V304A	probably benign	Het
Slc39a7	C	T	17: 34,031,267		probably benign	Het
Slco1a4	A	G	6: 141,815,582	V435A	possibly damaging	Het
Syne2	A	G	12: 75,927,466	E1146G	possibly damaging	Het
Tgm5	T	A	2: 121,048,823		probably benign	Het
Tgm7	A	G	2: 121,098,564	S284P	probably damaging	Het
Tmem132d	G	A	5: 127,795,923	R541W	probably damaging	Het
Tmem170	C	A	8: 111,869,717	V59L	probably benign	Het
Tpbgl	G	T	7: 99,626,026	A208E	possibly damaging	Het
Ttc23l	A	G	15: 10,523,592	I347T	possibly damaging	Het
Ulk1	T	C	5: 110,788,162	E827G	probably benign	Het
Vps13a	A	G	19: 16,710,426	V886A	possibly damaging	Het
Wrn	A	T	8: 33,324,556	C44S	probably benign	Het
Zscan22	T	A	7: 12,906,823	C331*	probably null	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- ACACCGGATCTGACTGCTTC -3'
(R):5'- AAACCCTTGGTCAGATGTCTACAG -3'

Sequencing Primer
(F):5'- TGACTGCTTCCACTCAAAATATATCC -3'
(R):5'- TGGTCAGATGTCTACAGTATCTTTC -3'

Posted On

2014-10-16