Incidental Mutation 'R2276:Scmh1'
ID242789
Institutional Source Beutler Lab
Gene Symbol Scmh1
Ensembl Gene ENSMUSG00000000085
Gene Namesex comb on midleg homolog 1
SynonymsScml3
MMRRC Submission 040275-MU
Accession Numbers

Ncbi RefSeq: NM_013883.2, NM_001159630.1; MGI:1352762

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2276 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location120405281-120530186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120483672 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 185 (C185F)
Ref Sequence ENSEMBL: ENSMUSP00000101908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000087] [ENSMUST00000064991] [ENSMUST00000106298] [ENSMUST00000106301]
Predicted Effect probably damaging
Transcript: ENSMUST00000000087
AA Change: C185F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000087
Gene: ENSMUSG00000000085
AA Change: C185F

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064991
AA Change: C185F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069813
Gene: ENSMUSG00000000085
AA Change: C185F

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 357 465 5.8e-39 PFAM
SAM 594 662 1.57e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106298
AA Change: C185F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101905
Gene: ENSMUSG00000000085
AA Change: C185F

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106301
AA Change: C185F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101908
Gene: ENSMUSG00000000085
AA Change: C185F

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.7e-50 PFAM
SAM 594 662 1.57e-10 SMART
Meta Mutation Damage Score 0.9586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (65/65)
MGI Phenotype Strain: 3706668
PHENOTYPE: Mice homozygous for an allele lacking the SPM domain exhibit partial penetrance of posterior vertebral transformations and male infertility with azoospermia and arrest of spermatogenesis. Mice homozygous for a knock-out allele exhibit abnormal hematopoiesis but normal fertility and skeleton. [provided by MGI curators]
Allele List at MGI

All alleles(67) : Targeted(4) Gene trapped(63)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Ankrd27 T C 7: 35,615,840 probably benign Het
Anxa3 T C 5: 96,830,490 probably null Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cep112 A T 11: 108,855,845 R176S probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cpped1 A C 16: 11,894,881 probably null Het
Cr2 T C 1: 195,157,368 R960G possibly damaging Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dnah6 G A 6: 73,113,581 S2210L probably benign Het
Dnajb12 C T 10: 59,892,977 T229I probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Epb41l2 T C 10: 25,488,944 probably benign Het
Fam178b A G 1: 36,632,458 L194P probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gimap9 A G 6: 48,677,878 H133R probably benign Het
Gpbp1 A T 13: 111,466,978 probably null Het
Gpr89 A G 3: 96,897,427 Y38H probably damaging Het
Gsdmc3 T A 15: 63,860,256 Y307F probably benign Het
Hip1 C T 5: 135,457,046 R101K probably damaging Het
Hist4h4 T A 6: 136,804,301 I27F probably damaging Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Igfn1 T C 1: 135,964,741 K2214E probably damaging Het
Itgal A T 7: 127,328,747 E1038V probably null Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kctd15 T C 7: 34,644,941 D95G possibly damaging Het
Kif1a A T 1: 93,068,477 probably benign Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lrrc7 A G 3: 158,179,792 F432L probably damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Nisch T C 14: 31,176,846 probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Osbpl2 G A 2: 180,148,526 G198S possibly damaging Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Ptpn4 T C 1: 119,684,591 D24G probably damaging Het
Rars2 T C 4: 34,656,835 S495P probably damaging Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rhou T C 8: 123,655,519 V100A probably damaging Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Sema3d A T 5: 12,542,582 Q326L possibly damaging Het
Sis T A 3: 72,914,601 K1376* probably null Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc26a5 A G 5: 21,823,547 V304A probably benign Het
Slc39a7 C T 17: 34,031,267 probably benign Het
Slco1a4 A G 6: 141,815,582 V435A possibly damaging Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tgm5 T A 2: 121,048,823 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem132d G A 5: 127,795,923 R541W probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tpbgl G T 7: 99,626,026 A208E possibly damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Ulk1 T C 5: 110,788,162 E827G probably benign Het
Vps13a A G 19: 16,710,426 V886A possibly damaging Het
Wrn A T 8: 33,324,556 C44S probably benign Het
Zscan22 T A 7: 12,906,823 C331* probably null Het
Other mutations in Scmh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Scmh1 APN 4 120529900 utr 3 prime probably benign
IGL01962:Scmh1 APN 4 120483584 splice site probably benign
IGL02013:Scmh1 APN 4 120483732 missense possibly damaging 0.77
IGL02081:Scmh1 APN 4 120515078 missense probably damaging 1.00
IGL02223:Scmh1 APN 4 120515219 missense probably benign 0.26
IGL02530:Scmh1 APN 4 120528146 splice site probably benign
IGL02887:Scmh1 APN 4 120468389 missense probably damaging 1.00
P0024:Scmh1 UTSW 4 120478034 missense probably damaging 1.00
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0200:Scmh1 UTSW 4 120483831 missense probably damaging 0.99
R1598:Scmh1 UTSW 4 120515130 missense possibly damaging 0.83
R1624:Scmh1 UTSW 4 120529228 missense probably damaging 1.00
R3734:Scmh1 UTSW 4 120478080 missense probably damaging 1.00
R4167:Scmh1 UTSW 4 120529276 intron probably benign
R4570:Scmh1 UTSW 4 120528298 missense probably damaging 1.00
R5458:Scmh1 UTSW 4 120505281 unclassified probably benign
R5564:Scmh1 UTSW 4 120468378 missense probably damaging 1.00
R5700:Scmh1 UTSW 4 120516946 missense probably benign 0.10
R5991:Scmh1 UTSW 4 120522620 missense probably benign
R5999:Scmh1 UTSW 4 120505515 critical splice donor site probably null
R7097:Scmh1 UTSW 4 120525055 missense probably benign
R7432:Scmh1 UTSW 4 120529156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGTAGAGGGGCACTTCC -3'
(R):5'- CTACAGGTGGCTCTTTACCTTTGG -3'

Sequencing Primer
(F):5'- CTTCCAACCAGGTACTTATGAGGAG -3'
(R):5'- GGCTCTTTACCTTTGGTGCCAG -3'
Posted On2014-10-16