Incidental Mutation 'R0172:Ap1m2'
ID24279
Institutional Source Beutler Lab
Gene Symbol Ap1m2
Ensembl Gene ENSMUSG00000003309
Gene Nameadaptor protein complex AP-1, mu 2 subunit
SynonymsD9Ertd818e, [m]1B, mu1B
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R0172 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21294275-21312337 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 21298332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000115433] [ENSMUST00000213250] [ENSMUST00000213762]
Predicted Effect probably null
Transcript: ENSMUST00000003397
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115433
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213483
Predicted Effect probably benign
Transcript: ENSMUST00000213762
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 1 (AP-1), which belongs to the adaptor complexes medium subunits family. This protein is capable of interacting with tyrosine-based sorting signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show small intestine crypt hyperplasia and villous dysplasia due to altered polarity and hyperproliferation of epithelial cells, exhibit spontaneous chronic colitis due to epithelial immune dysfunction, and develop a digestive disorder that causes malnutrition, growth retardation and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Ap1m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ap1m2 APN 9 21299304 missense probably benign 0.01
IGL02320:Ap1m2 APN 9 21299324 nonsense probably null
IGL02533:Ap1m2 APN 9 21296501 missense probably damaging 1.00
IGL02806:Ap1m2 APN 9 21305683 missense probably damaging 1.00
PIT1430001:Ap1m2 UTSW 9 21298252 missense probably damaging 0.98
R0498:Ap1m2 UTSW 9 21295833 makesense probably null
R1272:Ap1m2 UTSW 9 21305710 missense possibly damaging 0.85
R1424:Ap1m2 UTSW 9 21298204 missense possibly damaging 0.95
R1747:Ap1m2 UTSW 9 21305686 missense probably damaging 1.00
R4477:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4478:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4573:Ap1m2 UTSW 9 21305758 missense probably damaging 1.00
R4702:Ap1m2 UTSW 9 21298295 missense probably benign 0.24
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R5285:Ap1m2 UTSW 9 21305637 nonsense probably null
R6131:Ap1m2 UTSW 9 21296501 missense probably damaging 1.00
R6191:Ap1m2 UTSW 9 21299305 missense probably benign 0.02
R7262:Ap1m2 UTSW 9 21302466 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GTCCATTGCACAGACTTCAAAGTCAAG -3'
(R):5'- CCAGATTGAGGAACAAGAGTTAGCACC -3'

Sequencing Primer
(F):5'- gggagggagggagggag -3'
(R):5'- AAGAGTTAGCACCCTTCTCTTG -3'
Posted On2013-04-16