Incidental Mutation 'R2276:Akap11'
ID242826
Institutional Source Beutler Lab
Gene Symbol Akap11
Ensembl Gene ENSMUSG00000022016
Gene NameA kinase (PRKA) anchor protein 11
Synonyms6330501D17Rik
MMRRC Submission 040275-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2276 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location78492246-78536808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78510037 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1637 (I1637L)
Ref Sequence ENSEMBL: ENSMUSP00000116015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022593
AA Change: I1637L

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: I1637L

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1738 1755 N/A INTRINSIC
low complexity region 1767 1788 N/A INTRINSIC
Blast:AKAP_110 1790 1883 2e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000123853
AA Change: I1637L

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: I1637L

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1731 1756 N/A INTRINSIC
low complexity region 1768 1789 N/A INTRINSIC
Blast:AKAP_110 1791 1884 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227722
Meta Mutation Damage Score 0.0965 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,615,840 probably benign Het
Anxa3 T C 5: 96,830,490 probably null Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cep112 A T 11: 108,855,845 R176S probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cpped1 A C 16: 11,894,881 probably null Het
Cr2 T C 1: 195,157,368 R960G possibly damaging Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dnah6 G A 6: 73,113,581 S2210L probably benign Het
Dnajb12 C T 10: 59,892,977 T229I probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Epb41l2 T C 10: 25,488,944 probably benign Het
Fam178b A G 1: 36,632,458 L194P probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gimap9 A G 6: 48,677,878 H133R probably benign Het
Gpbp1 A T 13: 111,466,978 probably null Het
Gpr89 A G 3: 96,897,427 Y38H probably damaging Het
Gsdmc3 T A 15: 63,860,256 Y307F probably benign Het
Hip1 C T 5: 135,457,046 R101K probably damaging Het
Hist4h4 T A 6: 136,804,301 I27F probably damaging Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Igfn1 T C 1: 135,964,741 K2214E probably damaging Het
Itgal A T 7: 127,328,747 E1038V probably null Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kctd15 T C 7: 34,644,941 D95G possibly damaging Het
Kif1a A T 1: 93,068,477 probably benign Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lrrc7 A G 3: 158,179,792 F432L probably damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Nisch T C 14: 31,176,846 probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Osbpl2 G A 2: 180,148,526 G198S possibly damaging Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Ptpn4 T C 1: 119,684,591 D24G probably damaging Het
Rars2 T C 4: 34,656,835 S495P probably damaging Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rhou T C 8: 123,655,519 V100A probably damaging Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Scmh1 G T 4: 120,483,672 C185F probably damaging Het
Sema3d A T 5: 12,542,582 Q326L possibly damaging Het
Sis T A 3: 72,914,601 K1376* probably null Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc26a5 A G 5: 21,823,547 V304A probably benign Het
Slc39a7 C T 17: 34,031,267 probably benign Het
Slco1a4 A G 6: 141,815,582 V435A possibly damaging Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tgm5 T A 2: 121,048,823 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem132d G A 5: 127,795,923 R541W probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tpbgl G T 7: 99,626,026 A208E possibly damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Ulk1 T C 5: 110,788,162 E827G probably benign Het
Vps13a A G 19: 16,710,426 V886A possibly damaging Het
Wrn A T 8: 33,324,556 C44S probably benign Het
Zscan22 T A 7: 12,906,823 C331* probably null Het
Other mutations in Akap11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Akap11 APN 14 78511341 missense probably damaging 1.00
IGL00902:Akap11 APN 14 78495838 missense probably benign 0.11
IGL01752:Akap11 APN 14 78509878 critical splice donor site probably null
IGL01972:Akap11 APN 14 78507857 missense probably damaging 0.99
IGL02031:Akap11 APN 14 78513813 missense possibly damaging 0.50
IGL02239:Akap11 APN 14 78513849 missense probably damaging 1.00
IGL02528:Akap11 APN 14 78510867 missense probably damaging 1.00
IGL02884:Akap11 APN 14 78498962 missense probably benign 0.02
IGL03130:Akap11 APN 14 78510368 nonsense probably null
IGL03179:Akap11 APN 14 78507740 missense probably benign 0.00
IGL03240:Akap11 APN 14 78495905 missense probably damaging 0.99
IGL03331:Akap11 APN 14 78513865 missense probably damaging 1.00
bonham UTSW 14 78498864 nonsense probably null
R0004:Akap11 UTSW 14 78514940 missense possibly damaging 0.65
R0020:Akap11 UTSW 14 78518177 missense probably benign 0.37
R0200:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0281:Akap11 UTSW 14 78510089 missense possibly damaging 0.84
R0320:Akap11 UTSW 14 78513379 missense probably benign
R0381:Akap11 UTSW 14 78513550 missense probably benign 0.01
R0536:Akap11 UTSW 14 78514024 missense probably damaging 1.00
R0608:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0735:Akap11 UTSW 14 78510078 missense probably damaging 1.00
R1189:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1400:Akap11 UTSW 14 78513962 missense probably damaging 1.00
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1501:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1588:Akap11 UTSW 14 78510245 missense possibly damaging 0.50
R1717:Akap11 UTSW 14 78513348 missense probably benign 0.02
R1823:Akap11 UTSW 14 78511488 missense probably damaging 1.00
R1847:Akap11 UTSW 14 78513661 missense probably benign 0.00
R1874:Akap11 UTSW 14 78511866 missense probably benign 0.14
R2031:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2032:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2763:Akap11 UTSW 14 78518892 missense probably damaging 0.98
R4483:Akap11 UTSW 14 78510259 missense probably damaging 1.00
R4582:Akap11 UTSW 14 78511929 missense possibly damaging 0.81
R4857:Akap11 UTSW 14 78498860 missense
R4922:Akap11 UTSW 14 78512780 nonsense probably null
R4993:Akap11 UTSW 14 78512968 missense probably damaging 1.00
R5426:Akap11 UTSW 14 78498864 nonsense probably null
R5472:Akap11 UTSW 14 78513429 missense probably benign 0.03
R5683:Akap11 UTSW 14 78512578 missense probably damaging 0.98
R5774:Akap11 UTSW 14 78510967 missense probably damaging 1.00
R6014:Akap11 UTSW 14 78512499 missense probably benign 0.00
R6264:Akap11 UTSW 14 78512421 missense possibly damaging 0.68
R6270:Akap11 UTSW 14 78518799 missense probably damaging 1.00
R6319:Akap11 UTSW 14 78513538 missense probably benign 0.06
R6376:Akap11 UTSW 14 78514896 missense probably damaging 1.00
R6394:Akap11 UTSW 14 78522589 critical splice donor site probably null
R6536:Akap11 UTSW 14 78511314 missense possibly damaging 0.81
R7048:Akap11 UTSW 14 78512514 missense
R7147:Akap11 UTSW 14 78511465 missense
R7473:Akap11 UTSW 14 78513888 missense
R7503:Akap11 UTSW 14 78512001 missense
R7542:Akap11 UTSW 14 78510292 missense
R7618:Akap11 UTSW 14 78498860 missense
R7679:Akap11 UTSW 14 78514816 missense
R8094:Akap11 UTSW 14 78512973 missense
R8098:Akap11 UTSW 14 78512922 missense
R8226:Akap11 UTSW 14 78511209 missense
R8269:Akap11 UTSW 14 78513378 missense
R8304:Akap11 UTSW 14 78513232 missense
Predicted Primers PCR Primer
(F):5'- CAGGGCAAAGTTAACTCTTCATTC -3'
(R):5'- TAAGGAATTCCATGGTTGCACC -3'

Sequencing Primer
(F):5'- AAGGCTCTCAGCAAAGCT -3'
(R):5'- GGTTGCACCAGAAATTCTGC -3'
Posted On2014-10-16