Incidental Mutation 'R2278:Bpifb2'
ID242884
Institutional Source Beutler Lab
Gene Symbol Bpifb2
Ensembl Gene ENSMUSG00000027481
Gene NameBPI fold containing family B, member 2
Synonyms2310069A01Rik, Bpil1, 2310034L21Rik
MMRRC Submission 040277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2278 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location153875045-153895270 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 153878479 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 53 (Q53*)
Ref Sequence ENSEMBL: ENSMUSP00000028983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028983]
Predicted Effect probably null
Transcript: ENSMUST00000028983
AA Change: Q53*
SMART Domains Protein: ENSMUSP00000028983
Gene: ENSMUSG00000027481
AA Change: Q53*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 36 194 2.4e-27 PFAM
BPI2 253 456 2.67e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129776
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipid transfer/lipopolysaccharide binding protein (LT/LBP) gene family. It is highly expressed in hypertrophic tonsils. This gene and three other members of the LT/LBP gene family form a cluster on the long arm of chromosome 20. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,711,384 D251G probably damaging Het
Aqp3 T C 4: 41,093,836 D219G probably damaging Het
Arhgef15 C A 11: 68,951,691 W404C probably damaging Het
Bdp1 C A 13: 100,061,330 S849I probably benign Het
Bdp1 T A 13: 100,061,339 E846V probably damaging Het
Bmp5 T A 9: 75,776,548 N152K possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca3a1 A G 3: 144,758,024 V164A probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Gcn1l1 T C 5: 115,611,175 I1922T probably damaging Het
Gnpat A G 8: 124,876,920 D179G probably benign Het
Hook1 A G 4: 95,998,720 Q188R probably benign Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Ifi44 T C 3: 151,732,388 N421D probably benign Het
Igdcc4 C T 9: 65,130,743 T801I probably damaging Het
Itgad T C 7: 128,205,170 S107P possibly damaging Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kcnk18 T C 19: 59,235,494 I357T probably damaging Het
Kcnma1 T A 14: 23,543,083 R120* probably null Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lypla1 T G 1: 4,841,098 probably null Het
Mknk1 C T 4: 115,875,493 A306V probably damaging Het
Ncoa6 A T 2: 155,407,650 S1245T possibly damaging Het
Npas3 T A 12: 53,640,502 V122E possibly damaging Het
Nrxn2 G C 19: 6,481,853 Q789H probably damaging Het
Olfr1135 A G 2: 87,671,945 C141R possibly damaging Het
Olfr410 T C 11: 74,335,165 E22G probably benign Het
Olfr494 T C 7: 108,368,081 V197A probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Otog G A 7: 46,300,044 V2369M probably damaging Het
Pfkp T C 13: 6,619,209 probably null Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prune2 A G 19: 17,118,555 I474M possibly damaging Het
Psg22 C A 7: 18,726,837 Q464K possibly damaging Het
Rp1 C T 1: 4,348,027 S954N possibly damaging Het
Rps27l T A 9: 66,946,926 D34E probably benign Het
Sae1 A C 7: 16,370,366 L106R probably damaging Het
Siglec1 T A 2: 131,071,337 Q1553L probably benign Het
Slc11a2 A G 15: 100,410,081 probably null Het
Slc14a2 A T 18: 78,159,944 M556K probably benign Het
Slk T G 19: 47,619,749 I380M probably damaging Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tiam2 G A 17: 3,427,220 V573M probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tmem255b C T 8: 13,451,081 A106V probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Vps13c A G 9: 67,939,072 M2141V probably benign Het
Vwa5a T C 9: 38,723,207 Y143H probably damaging Het
Zfp280d T A 9: 72,338,773 C707* probably null Het
Zfp668 A T 7: 127,866,826 N395K probably benign Het
Znhit6 G T 3: 145,576,236 probably benign Het
Other mutations in Bpifb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Bpifb2 APN 2 153891275 splice site probably benign
IGL02164:Bpifb2 APN 2 153883562 missense probably damaging 0.99
IGL03063:Bpifb2 APN 2 153889124 missense probably damaging 1.00
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0084:Bpifb2 UTSW 2 153891091 missense probably benign 0.03
R0791:Bpifb2 UTSW 2 153878519 missense probably benign 0.05
R1503:Bpifb2 UTSW 2 153889510 missense possibly damaging 0.83
R3810:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R3812:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R4030:Bpifb2 UTSW 2 153891317 missense probably benign 0.30
R4573:Bpifb2 UTSW 2 153889492 missense probably damaging 0.99
R4713:Bpifb2 UTSW 2 153881193 missense probably damaging 0.98
R5143:Bpifb2 UTSW 2 153878504 missense probably damaging 1.00
R5523:Bpifb2 UTSW 2 153875985 unclassified probably benign
R5899:Bpifb2 UTSW 2 153891130 missense probably damaging 1.00
R6011:Bpifb2 UTSW 2 153889576 splice site probably null
R6172:Bpifb2 UTSW 2 153890412 missense probably benign 0.15
R6378:Bpifb2 UTSW 2 153891152 missense possibly damaging 0.93
R6878:Bpifb2 UTSW 2 153875912 unclassified probably benign
R7381:Bpifb2 UTSW 2 153892348 missense probably benign 0.01
R7390:Bpifb2 UTSW 2 153889806 missense possibly damaging 0.89
R7424:Bpifb2 UTSW 2 153890540 missense possibly damaging 0.93
R7473:Bpifb2 UTSW 2 153881196 missense possibly damaging 0.80
R7493:Bpifb2 UTSW 2 153889477 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GAATCGGGTACATTGCATGGG -3'
(R):5'- GAGGCTCTCCAGTAAAGCTC -3'

Sequencing Primer
(F):5'- TACATTGCATGGGCTAGCC -3'
(R):5'- GGCTCTCCAGTAAAGCTCATTTAAG -3'
Posted On2014-10-16