Incidental Mutation 'R2278:Aqp3'
ID 242891
Institutional Source Beutler Lab
Gene Symbol Aqp3
Ensembl Gene ENSMUSG00000028435
Gene Name aquaporin 3
Synonyms RP23-28I8.7, AQP-2, OTTMUSP00000006982, GIL, Gill blood group
MMRRC Submission 040277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2278 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 41092722-41098183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41093836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 219 (D219G)
Ref Sequence ENSEMBL: ENSMUSP00000055110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055327]
AlphaFold Q8R2N1
Predicted Effect probably damaging
Transcript: ENSMUST00000055327
AA Change: D219G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055110
Gene: ENSMUSG00000028435
AA Change: D219G

DomainStartEndE-ValueType
Pfam:MIP 16 261 5.9e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154722
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Animals homozygous for a mutation in this gene display increased drinking behavior, increased urination, and decreased urine osmolality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,711,384 D251G probably damaging Het
Arhgef15 C A 11: 68,951,691 W404C probably damaging Het
Bdp1 C A 13: 100,061,330 S849I probably benign Het
Bdp1 T A 13: 100,061,339 E846V probably damaging Het
Bmp5 T A 9: 75,776,548 N152K possibly damaging Het
Bpifb2 C T 2: 153,878,479 Q53* probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca3a1 A G 3: 144,758,024 V164A probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Gcn1l1 T C 5: 115,611,175 I1922T probably damaging Het
Gnpat A G 8: 124,876,920 D179G probably benign Het
Hook1 A G 4: 95,998,720 Q188R probably benign Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Ifi44 T C 3: 151,732,388 N421D probably benign Het
Igdcc4 C T 9: 65,130,743 T801I probably damaging Het
Itgad T C 7: 128,205,170 S107P possibly damaging Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kcnk18 T C 19: 59,235,494 I357T probably damaging Het
Kcnma1 T A 14: 23,543,083 R120* probably null Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lypla1 T G 1: 4,841,098 probably null Het
Mknk1 C T 4: 115,875,493 A306V probably damaging Het
Ncoa6 A T 2: 155,407,650 S1245T possibly damaging Het
Npas3 T A 12: 53,640,502 V122E possibly damaging Het
Nrxn2 G C 19: 6,481,853 Q789H probably damaging Het
Olfr1135 A G 2: 87,671,945 C141R possibly damaging Het
Olfr410 T C 11: 74,335,165 E22G probably benign Het
Olfr494 T C 7: 108,368,081 V197A probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Otog G A 7: 46,300,044 V2369M probably damaging Het
Pfkp T C 13: 6,619,209 probably null Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prune2 A G 19: 17,118,555 I474M possibly damaging Het
Psg22 C A 7: 18,726,837 Q464K possibly damaging Het
Rp1 C T 1: 4,348,027 S954N possibly damaging Het
Rps27l T A 9: 66,946,926 D34E probably benign Het
Sae1 A C 7: 16,370,366 L106R probably damaging Het
Siglec1 T A 2: 131,071,337 Q1553L probably benign Het
Slc11a2 A G 15: 100,410,081 probably null Het
Slc14a2 A T 18: 78,159,944 M556K probably benign Het
Slk T G 19: 47,619,749 I380M probably damaging Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tiam2 G A 17: 3,427,220 V573M probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tmem255b C T 8: 13,451,081 A106V probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Vps13c A G 9: 67,939,072 M2141V probably benign Het
Vwa5a T C 9: 38,723,207 Y143H probably damaging Het
Zfp280d T A 9: 72,338,773 C707* probably null Het
Zfp668 A T 7: 127,866,826 N395K probably benign Het
Znhit6 G T 3: 145,576,236 probably benign Het
Other mutations in Aqp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Aqp3 APN 4 41093632 missense probably damaging 1.00
IGL02994:Aqp3 APN 4 41093614 missense probably benign 0.09
phoebus UTSW 4 41095252 missense probably benign 0.05
R0138:Aqp3 UTSW 4 41094843 splice site probably benign
R2097:Aqp3 UTSW 4 41098004 missense possibly damaging 0.95
R2128:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2129:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R5013:Aqp3 UTSW 4 41093819 missense probably damaging 1.00
R7176:Aqp3 UTSW 4 41095202 missense probably damaging 1.00
R7365:Aqp3 UTSW 4 41098003 missense probably benign 0.14
R7385:Aqp3 UTSW 4 41095178 missense probably damaging 0.97
R9282:Aqp3 UTSW 4 41093640 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGGGCCAGCTTCACATTCTC -3'
(R):5'- CTCTCCCAGTTCATAGGCACAG -3'

Sequencing Primer
(F):5'- TGGCAACCAATCATGAGCTG -3'
(R):5'- ACAGCCGCCCTTATTGTGTG -3'
Posted On 2014-10-16