Incidental Mutation 'R2278:Hook1'
ID242892
Institutional Source Beutler Lab
Gene Symbol Hook1
Ensembl Gene ENSMUSG00000028572
Gene Namehook microtubule tethering protein 1
Synonymsazh, A930033L17Rik, abnormal spermatozoon head shape
MMRRC Submission 040277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2278 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location95967240-96025413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95998720 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 188 (Q188R)
Ref Sequence ENSEMBL: ENSMUSP00000102698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030306] [ENSMUST00000107083]
Predicted Effect probably benign
Transcript: ENSMUST00000030306
AA Change: Q188R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030306
Gene: ENSMUSG00000028572
AA Change: Q188R

DomainStartEndE-ValueType
Pfam:HOOK 14 720 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107083
AA Change: Q188R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102698
Gene: ENSMUSG00000028572
AA Change: Q188R

DomainStartEndE-ValueType
Pfam:HOOK 7 219 2e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146947
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have abnormal ladle shaped sperm with up to 40% lacking a flagella. Nonetheless, most males breed, although litter size is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,711,384 D251G probably damaging Het
Aqp3 T C 4: 41,093,836 D219G probably damaging Het
Arhgef15 C A 11: 68,951,691 W404C probably damaging Het
Bdp1 C A 13: 100,061,330 S849I probably benign Het
Bdp1 T A 13: 100,061,339 E846V probably damaging Het
Bmp5 T A 9: 75,776,548 N152K possibly damaging Het
Bpifb2 C T 2: 153,878,479 Q53* probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca3a1 A G 3: 144,758,024 V164A probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Gcn1l1 T C 5: 115,611,175 I1922T probably damaging Het
Gnpat A G 8: 124,876,920 D179G probably benign Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Ifi44 T C 3: 151,732,388 N421D probably benign Het
Igdcc4 C T 9: 65,130,743 T801I probably damaging Het
Itgad T C 7: 128,205,170 S107P possibly damaging Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kcnk18 T C 19: 59,235,494 I357T probably damaging Het
Kcnma1 T A 14: 23,543,083 R120* probably null Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lypla1 T G 1: 4,841,098 probably null Het
Mknk1 C T 4: 115,875,493 A306V probably damaging Het
Ncoa6 A T 2: 155,407,650 S1245T possibly damaging Het
Npas3 T A 12: 53,640,502 V122E possibly damaging Het
Nrxn2 G C 19: 6,481,853 Q789H probably damaging Het
Olfr1135 A G 2: 87,671,945 C141R possibly damaging Het
Olfr410 T C 11: 74,335,165 E22G probably benign Het
Olfr494 T C 7: 108,368,081 V197A probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Otog G A 7: 46,300,044 V2369M probably damaging Het
Pfkp T C 13: 6,619,209 probably null Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prune2 A G 19: 17,118,555 I474M possibly damaging Het
Psg22 C A 7: 18,726,837 Q464K possibly damaging Het
Rp1 C T 1: 4,348,027 S954N possibly damaging Het
Rps27l T A 9: 66,946,926 D34E probably benign Het
Sae1 A C 7: 16,370,366 L106R probably damaging Het
Siglec1 T A 2: 131,071,337 Q1553L probably benign Het
Slc11a2 A G 15: 100,410,081 probably null Het
Slc14a2 A T 18: 78,159,944 M556K probably benign Het
Slk T G 19: 47,619,749 I380M probably damaging Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tiam2 G A 17: 3,427,220 V573M probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tmem255b C T 8: 13,451,081 A106V probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Vps13c A G 9: 67,939,072 M2141V probably benign Het
Vwa5a T C 9: 38,723,207 Y143H probably damaging Het
Zfp280d T A 9: 72,338,773 C707* probably null Het
Zfp668 A T 7: 127,866,826 N395K probably benign Het
Znhit6 G T 3: 145,576,236 probably benign Het
Other mutations in Hook1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Hook1 APN 4 96022197 missense probably benign 0.25
IGL02229:Hook1 APN 4 96001251 missense possibly damaging 0.93
IGL03338:Hook1 APN 4 95998692 splice site probably benign
PIT4453001:Hook1 UTSW 4 96014852 missense probably damaging 0.99
R0558:Hook1 UTSW 4 95993212 splice site probably benign
R0593:Hook1 UTSW 4 95998786 missense possibly damaging 0.93
R0699:Hook1 UTSW 4 95995840 splice site probably benign
R1004:Hook1 UTSW 4 96022287 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R2140:Hook1 UTSW 4 96013312 frame shift probably null
R3784:Hook1 UTSW 4 95989651 missense probably damaging 1.00
R4500:Hook1 UTSW 4 95993200 critical splice donor site probably null
R4798:Hook1 UTSW 4 96002557 missense possibly damaging 0.84
R5200:Hook1 UTSW 4 95993130 missense probably damaging 1.00
R5546:Hook1 UTSW 4 96002528 missense probably benign 0.03
R6532:Hook1 UTSW 4 96019756 intron probably null
R6629:Hook1 UTSW 4 96001270 missense probably benign 0.03
R7010:Hook1 UTSW 4 96014811 missense probably damaging 0.99
R7534:Hook1 UTSW 4 96017597 missense probably benign 0.27
X0027:Hook1 UTSW 4 95995811 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACAAGGCAACGCATGAAG -3'
(R):5'- TCTATTAGCAGGTCACGCATTACTTAC -3'

Sequencing Primer
(F):5'- GCAACGCATGAAGACTCATTAG -3'
(R):5'- GGTCACGCATTACTTACTACAAC -3'
Posted On2014-10-16